Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.

Patents

  1. Advanced Patent Search
Publication numberWO2008070257 A2
Publication typeApplication
Application numberPCT/US2007/080128
Publication dateJun 12, 2008
Filing dateOct 1, 2007
Priority dateSep 29, 2006
Also published asEP2066789A2, EP2066789A4, WO2008070257A3, WO2008070257A9
Publication numberPCT/2007/80128, PCT/US/2007/080128, PCT/US/2007/80128, PCT/US/7/080128, PCT/US/7/80128, PCT/US2007/080128, PCT/US2007/80128, PCT/US2007080128, PCT/US200780128, PCT/US7/080128, PCT/US7/80128, PCT/US7080128, PCT/US780128, WO 2008/070257 A2, WO 2008070257 A2, WO 2008070257A2, WO-A2-2008070257, WO2008/070257A2, WO2008070257 A2, WO2008070257A2
InventorsMichael Richard Kevin Alley, Fernando Rock, Weimin Mao
ApplicantAnacor Pharmaceuticals, Inc.
Export CitationBiBTeX, EndNote, RefMan
External Links: Patentscope, Espacenet
Crystal structure of a trna synthetase
WO 2008070257 A2
Abstract
The present invention relates to tRNA synthetases, and in particular the use of its crystal structure for drug discovery.
Claims  (OCR text may contain errors)
WHAT IS CLAIMED IS:
1. A crystal comprising: bacterial leucyl tRNA synthetase; adenosine-containing moiety; and ligand wherein said ligand interacts with the editing domain of the tRNA synthetase.
2. The crystal of claim 1 , having a space group of p212121.
3. The crystal of claim 1, wherein said ligand is bound to the editing domain.
4. The crystal of claim 1, wherein said bacterial leucyl tRNA synthetase is a member selected from a mitochondrial tRNA synthetase and a cytoplasmic tRNA synthetase.
5. The crystal of claim 1, wherein said bacterial leucyl tRNA synthetase has a sequence which is a member selected from the wild-type, homolog or mutant of a member selected from Acinetobacter spp., Bacteroides spp., Burkholderia spp., Enteric bacteria, Enterococcus spp., Pseudomonas spp., Haemophilus spp., Strepococcus spp., and Staphylococcus spp., Stenotrophomonas maltophilia, Clostridium difficile, Propionibacter acnes, Bacillus anthracis, Mycobacterium tuberculosis, Escheria CoIi and Thermus thermophilus .
6. The crystal of claim 1, wherein said tRNA synthetase is obtained from a bacterial preparation.
7. The crystal of claim 6, wherein said bacterial preparation is a culture of a member selected from Acinetobacter spp., Bacteroides spp., Burkholderia spp., Enteric bacteria, Enterococcus spp., Pseudomonas spp., Haemophilus spp., Strepococcus spp., and Staphylococcus spp., Stenotrophomonas maltophilia, Clostridium difficile, Propionibacter acnes, Bacillus anthracis, Mycobacterium tuberculosis, Escheria CoIi and Thermus thermophilus.
8. The crystal of claim 1, wherein said ligand is a boron-containing compound.
9. The crystal of claim 8, wherein said boron-containing compound is an oxaborole.
10. The crystal of claim 8, wherein said boron-containing compound has a structure according to the following formula:
wherein
R1 is a member selected from a negative charge, a salt counterion, H, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl;
R3 and R4 are members independently selected from H, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl;
R > 9 , r R> 10 , r R> H and J R , 12 are members independently selected from H, OR* , NR*R ** SR*, -S(O)R*, -S(O)2R*, -S(O)2NR*R**, -C(O)R*, -C(O)OR*, - C(O)NR*R**, nitro, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl;
wherein each R* and R** are members independently selected from H, nitro, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl;
R3 and R4, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring;
R9 and R10, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring;
R10 and R11, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring; and
R11 and R12, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring.
11. The crystal of claim 8, wherein each R3 and R4 is a member independently selected from H, cyano, substituted or unsubstituted methyl, substituted or unsubstituted ethyl, trifluoromethyl, substituted or unsubstituted hydroxymethyl, substituted or unsubstituted hydroxyalkyl, substituted or unsubstituted benzyl, substituted or unsubstituted phenyl, substituted or unsubstituted mercaptomethyl, substituted or unsubstituted mercaptoalkyl, substituted or unsubstituted aminomethyl, substituted or unsubstituted alkylaminomethyl, substituted or unsubstituted dialkylaminomethyl, substituted or unsubstituted arylaminomethyl, substituted or unsubstituted indolyl and substituted or unsubstituted amido.
12. The crystal of claim 8, wherein R3 is H and R4 is a member independently selected from cyano, substituted or unsubstituted methyl, substituted or unsubstituted ethyl, trifluoromethyl, substituted or unsubstituted hydroxymethyl, substituted or unsubstituted hydroxyalkyl, substituted or unsubstituted benzyl, substituted or unsubstituted phenyl, substituted or unsubstituted mercaptomethyl, substituted or unsubstituted mercaptoalkyl, substituted or unsubstituted aminomethyl, substituted or unsubstituted alkylaminomethyl, substituted or unsubstituted dialkylaminomethyl, substituted or unsubstituted arylaminomethyl, substituted or unsubstituted indolyl, substituted or unsubstituted amido.
13. The crystal of claim 8, wherein R3 is H and R4 is substituted or unsubstituted aminomethyl.
14. The crystal of claim 8, wherein R3 is H; R4 is H, and R9, R10, R11 and R12 are members independently selected from H, OR*, NR*R**, SR*, -S(O)R*, - S(O)2R*, -S(O)2NR*R**, -C(O)R*, -C(O)OR*, -C(O)NR*R**, halogen, cyano, nitro, substituted or unsubstituted methoxy, substituted or unsubstituted methyl, substituted or unsubstituted ethoxy, substituted or unsubstituted ethyl, trifluoromethyl, substituted or unsubstituted hydroxymethyl, substituted or unsubstituted hydroxyalkyl, substituted or unsubstituted benzyl, substituted or unsubstituted phenyl, substituted or unsubstituted phenyloxy, substituted or unsubstituted phenyl methoxy, substituted or unsubstituted thiophenyloxy, substituted or unsubstituted pyridinyloxy, substituted or unsubstituted pyrimidinyloxy, substituted or unsubstituted benzylfuran, substituted or unsubstituted methylthio, substituted or unsubstituted mercaptomethyl, substituted or unsubstituted mercaptoalkyl, substituted or unsubstituted phenylthio, substituted or unsubstituted thiophenylthio, substituted or unsubstituted phenyl methylthio, substituted or unsubstituted pyridinylthio, substituted or unsubstituted pyrimidinylthio, substituted or unsubstituted benzylthiofuranyl, substituted or unsubstituted phenylsulfonyl, substituted or unsubstituted benzylsulfonyl, substituted or unsubstituted phenylmethylsulfonyl, substituted or unsubstituted thiophenylsulfonyl, substituted or unsubstituted pyridinylsulfonyl, substituted or unsubstituted pyrimidinylsulfonyl, substituted or unsubstituted sulfonamidyl, substituted or unsubstituted phenylsulfmyl, substituted or unsubstituted benzylsulfϊnyl, substituted or unsubstituted phenylmethylsulfmyl, substituted or unsubstituted thiophenylsulfϊnyl, substituted or unsubstituted pyridinylsulfmyl, substituted or unsubstituted pyrimidinylsulfmyl, substituted or unsubstituted amino, substituted or unsubstituted alkylamino, substituted or unsubstituted dialkylamino, substituted or unsubstituted trifluoromethylamino, substituted or unsubstituted aminomethyl, substituted or unsubstituted alkylaminomethyl, substituted or unsubstituted dialkylaminomethyl, substituted or unsubstituted arylaminomethyl, substituted or unsubstituted benzylamino, substituted or unsubstituted phenylamino, substituted or unsubstituted thiophenylamino, substituted or unsubstituted pyridinylamino, substituted or unsubstituted pyrimidinylamino, substituted or unsubstituted indolyl, substituted or unsubstituted morpholino, substituted or unsubstituted alkylamido, substituted or unsubstituted arylamido, substituted or unsubstituted ureido, substituted or unsubstituted carbamoyl, and substituted or unsubstituted piperizinyl.
15. The crystal of claim 8, wherein said boron-containing compound is a member selected from Cl, C2, C3, C4, C5, C6, C7 and C8.
16. The crystal of claim 1, wherein said adenosine-containing moiety has a structure which is a member selected from:
wherein L is substituted or unsubstituted adenine; A is a member selected from OH, substituted or unsubstituted monophosphate, substituted or unsubstituted diphosphate, substituted or unsubstituted
O
A1 O P O. , triphosphate, O I" V ; and
wherein Al is a nucleic acid sequence which comprises between 1 and 200 nucleotides.
17. The crystal of claim 16, wherein said Al is a nucleic acid sequence which is a leucyl tRNA or a portion of a leucyl tRNA.
18. The crystal of claim 16, wherein said Al is a nucleic acid sequence which is a leucyl tRNA or a portion of a leucyl tRNA of a member selected from Acinetobacter spp., Bacteroides spp., Burkholderia spp., Enteric bacteria, Enterococcus spp., Pseudomonas spp., Haemophilus spp., Strepococcus spp., and Staphylococcus spp., Stenotrophomonas maltophilia, Clostridium difficile, Propionibacter acnes, Bacillus anthracis, Mycobacterium tuberculosis, Escheria CoIi and Thermus thermophilus .
19. A method of identifying a ligand for a bacterial leucyl tRNA synthetase, said method comprising: a) providing a model comprising an editing domain of said bacterial leucyl tRNA synthetase; b) providing the structure of the ligand and; c) fitting the ligand to said editing domain, including determining the interactions between the ligand and at least one of said binding sites. d) selecting the fitted ligand, thereby identifying the ligand for said bacterial leucyl tRNA synthetase.
20. The method of claim 19, wherein said ligand is a boron-containing compound.
21. The method of claim 20, wherein said boron-containing compound has a structure according to the following formula:
wherein
R1 is a member selected from a negative charge, a salt counterion, H, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl;
R3 and R4 are members independently selected from H, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl;
R9, R10, R11 and R12 are members independently selected from H, OR*, NR*R**, SR*, -S(O)R*, -S(O)2R*, -S(O)2NR*R**, -C(O)R*, -C(O)OR*, - C(O)NR*R**, nitro, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl;
wherein each R* and R** are members independently selected from H, nitro, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl;
R3 and R4, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring;
R9 and R10, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring;
R10 and R11, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring; and
R11 and R12, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring.
22. The method of claim 21, wherein said boron-containing compound is a member selected from: Cl, C2, C3, C4, C5, C6, C7 and C8.
23. A method of identifying a ligand for a bacterial leucyl tRNA synthetase in which the structure of said bacterial leucyl tRNA synthetase is unknown; said method comprising: a) comparing the sequence of said bacterial leucyl tRNA synthetase against the sequence of a second leucyl tRNA synthetase, wherein the structure of said second leucyl tRNA synthetase is known and a ligand of said second leucyl tRNA synthetase is known; b) fitting the structure of said bacterial leucyl tRNA synthetase to the structure of the second leucyl tRNA synthetase; c) comparing the interactions between said bacterial leucyl tRNA synthetase and the ligand of said second leucyl tRNA synthetase; d) altering the structure of the ligand in order to increase the binding interactions between said ligand and said tRNA synthetase, thereby identifying said ligand.
24. The method of claim 23, wherein said ligand is a boron-containing compound.
25. The method of claim 23, wherein said boron-containing compound has a structure according to the following formula:
wherein
R1 is a member selected from a negative charge, a salt counterion, H, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl;
R3 and R4 are members independently selected from H, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl;
R9, R10, R11 and R12 are members independently selected from H, OR*, NR*R**, SR*, -S(O)R*, -S(O)2R*, -S(O)2NR*R**, -C(O)R*, -C(O)OR*, - C(0)NR*R**, nitro, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl;
wherein each R* and R** are members independently selected from H, nitro, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl;
R3 and R4, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring;
R9 and R10, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring;
R10 and R11, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring; and
R11 and R12, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring.
26. The method of claim 25, wherein said boron-containing compound is a member selected from Cl, C2, C3, C4, C5, C6, C7 and C8.
27. A computer-based method for the analysis of the interaction of a ligand structure with a bacterial leucyl tRNA synthetase structure, which comprises: providing the bacterial leucyl tRNA synthetase structure or selected coordinates thereof; providing a ligand structure to be fitted to said bacterial leucyl tRNA synthetase structure or selected coordinates thereof; and fitting the ligand structure to said bacterial leucyl tRNA synthetase structure.
28. The method of claim 27, further comprising: providing an adenosine-containing moiety structure to be fitted to said bacterial leucyl tRNA synthetase structure or selected coordinates thereof.
29. The method of claim 27 wherein said bacterial leucyl tRNA synthetase selected coordinates include atoms from one or more of the residues of the binding pocket of the editing domain.
30. The method of claim 27 which further comprises modifying the ligand structure to change its interaction with one or more of the bacterial leucyl tRNA synthetase selected coordinates.
31. The method of claim 27 which further comprises the steps of : obtaining or synthesising a ligand which has said ligand structure; and contacting said ligand with a bacterial leucyl tRNA synthetase to determine the ability of said ligand to interact with said bacterial leucyl tRNA synthetase.
32. The method of claim 27 which further comprises the steps of: obtaining or synthesising a ligand which has said ligand structure; obtaining or synthesising an adenosine-containing moiety which has said adenosine-containing moiety structure; forming a complex of a bacterial leucyl tRNA synthetase and said ligand and said adenosine-containing moiety; and analysing said complex by X-ray crystallography to determine the ability of said ligand to interact with said bacterial leucyl tRNA synthetase.
33. A method for determining the structure of a ligand bound to bacterial leucyl tRNA synthetase, said method comprising: providing a crystal of bacterial leucyl tRNA synthetase; soaking the crystal with a ligand and an adenosine-containing moiety to form a complex; and determining the structure of the complex by employing the data of FIG. 1 or FIG. 3 or a portion thereof.
34. A method for determining the structure of a ligand bound to bacterial leucyl tRNA synthetase, said method comprising: mixing bacterial leucyl tRNA synthetase with the ligand and an adenosine-containing moiety; crystallising a leucyl tRNA synthetase/adenosine-containing moiety/ligand complex; and determining the structure of the complex by employing the data of FIG. 1 or FIG. 3 or a portion thereof.
35. A computer-based method for the analysis of the interaction of two ligands within a bacterial leucyl tRNA synthetase editing domain binding pocket, which comprises: providing the bacterial leucyl tRNA synthetase structure of FIG. 1 or FIG. 3 or selected coordinates thereof which include coordinates of at least one of the residues of the editing domain; providing a first ligand structure to be fitted to said selected coordinates of residues of said region; fitting the first ligand structure to said bacterial leucyl tRNA synthetase structure including at least one of the selected coordinates thereof; providing a second ligand structure; and fitting the second ligand structure to said leucyl tRNA synthetase structure.
l-SF/7488919.1
36. The method of claim 34 wherein said first or second ligand structure fitted to the editing domain is a member selected from adenosine, adenosine- containing moiety, tRNAleu, a boron-containing compound, and 5-fluoro-l,3-dihydro-l- hydroxy-2,l-benzoxaborole.
37. The method of claim 35 which further comprises modifying the ligand structure fitted to said binding pocket of the editing domain.
38. A computer system, intended to generate structures and/or perform optimization of compounds which interact with bacterial leucyl tRNA synthetase, bacterial leucyl tRNA synthetase homo logs or analogs, complexes of bacterial leucyl tRNA synthetase with a ligand, or complexes of bacterial leucyl tRNA synthetase homologs or analogs with a ligand, the system containing computer-readable data comprising one or more of: (a) atomic coordinate data according to FIG. 1 or FIG. 3, said data defining the three-dimensional structure of bacterial leucyl t-RNA synthetase or at least selected coordinates thereof; (b) structure factor data for bacterial leucyl tRNA synthetase, said structure factor data being derivable from the atomic coordinate data of FIG. 1 or FIG. 3; (c) atomic coordinate data of a target bacterial leucyl tRNA synthetase protein generated by homology modeling of the target based on the data of FIG. 1 or FIG. 3; (d) atomic coordinate data of a target bacterial leucyl tRNA synthetase protein generated by interpreting X-ray crystallographic data or NMR data by reference to the data of FIG. 1 or FIG. 3; and (e) structure factor data derivable from the atomic coordinate data of (c) or (d).
39. The computer system of claim 38, wherein said atomic coordinate data is for at least one of the atoms of the binding pocket of the editing domain.
40. The computer system of claim 38 comprising: (i) a computer- readable data storage medium comprising data storage material encoded with said computer-readable data; (ii) a working memory for storing instructions for processing said computer-readable data; and (iii) a central-processing unit coupled to said working memory and to said computer-readable data storage medium for processing said computer-readable data and thereby generating structures and/or performing rational drug design.
41. The computer system of claim 38 further comprising a display coupled to said central-processing unit for displaying said structures.
42. A method of providing data for generating ligand structures and/or performing optimisation of ligands which interact with bacterial leucyl tRNA synthetase, bacterial leucyl tRNA synthetase homologs or analogs, complexes of bacterial leucyl tRNA synthetase with a ligand, or complexes of bacterial leucyl tRNA synthetase homologs or analogs with a ligand, the method comprising: (i) establishing communication with a remote device containing computer-readable data comprising at least one of:
(a) atomic coordinate data according to FIG. 1 or FIG. 3, said data defining the three-dimensional structure of bacterial leucyl tRNA synthetase, or the coordinates of a plurality of atoms of bacterial leucyl tRNA synthetase; (b) structure factor data for bacterial leucyl tRNA synthetase, said structure factor data being derivable from the atomic coordinate data of FIG. 1 or FIG. 3; (c) atomic coordinate data of a target bacterial leucyl tRNA synthetase homo log or analog generated by homology modeling of the target based on the data of FIG. 1 or FIG. 3; (d) atomic coordinate data of a protein generated by interpreting X-ray crystallographic data or NMR data by reference to the data of FIG. 1 or FIG. 3; and (e) structure factor data derivable from the atomic coordinate data of (c) or (d); and (ii) receiving said computer-readable data from said remote device.
Description  (OCR text may contain errors)

PATENT APPLICATION

CRYSTAL STRUCTURE OF A tRNA SYNTHETASE

BRIEF SUMMARY OF THE INVENTION

[0001] The present invention is at least partly based on overcoming several technical hurdles: (i) production of crystals of bacterial leucyl tRNA synthetase of suitable quality for performing X-ray diffraction analyses, (ii) forming bacterial leucyl tRNA synthetase/adenosine-containing moiety/ligand complexes by soaking the crystals in appropriate soaking solutions, (iii) collecting X-ray diffraction data from the bacterial leucyl tRNA synthetase/adenosine-containing moiety/ligand complexes, (iv) determining the three-dimensional structures of the complexes, (v) identifying regions of the editing domain of bacterial leucyl tRNA synthetase which undergo conformational changes upon ligand binding, (vi) discovering that oxaboroles and cyclic boronic esters can inhibit the editing domain of bacterial leucyl tRNA synthetases, (vii) discovering that a particular oxaborole, 5-fluoro-l,3-dihydro-l-hydroxy-2,l-benzoxaborole (Cl), inhibits the editing domain of bacterial leucyl tRNA synthetases, (viii) determining the likely mechanism by which Cl accomplishes inhibition of the editing domain of leucine tRNA synthetase; and (ix) using this information to identify new ligands that are better inhibitors of the editing domain of bacterial leucyl tRNA synthetase.

[0002] In general aspects, the present invention is concerned with identifying or obtaining agent compounds (especially inhibitors of the editing domain of leucine tRNA synthetase) for modulating leucine tRNA synthetase activity, and in preferred embodiments identifying or obtaining actual agent compounds/inhibitors. In an exemplary embodiment, the agent compounds are oxaboroles, cyclic boronic esters or cyclic borinic esters. In another exemplary embodiment, the agent compound is 5-fluoro- l,3-dihydro-l-hydroxy-2,l-benzoxaborole. Crystal structure information presented herein is useful in designing potential inhibitors and modeling them or their potential interaction with the leucine tRNA synthetase editing domain. Potential inhibitors may be brought into contact with leucine tRNA synthetase to test for their ability to interact with the leucine tRNA synthetase editing domain. Actual inhibitors may be identified from among potential inhibitors synthesized following design and model work performed in silico. An inhibitor identified using the present invention may be formulated into a composition, for instance a composition comprising a pharmaceutically acceptable excipient, and may be used in the manufacture of a medicament for use in a method of treatment. These and other aspects and embodiments of the present invention are discussed below.

[0003] A first aspect of the invention provides a co-crystal of leucine tRNA synthetase along with adenosine monophosphate (AMP) and 5-fluoro-l,3-dihydro-l- hydroxy-2,l-benzoxaborole. Alternatively or additionally, the crystal has the three dimensional atomic coordinates of FIG. 1. An advantageous feature of the structural data according to FIG. 1 are that they have a high resolution of about 1.55 angstroms.

[0004] A second aspect of the invention provides a co-crystal of leucine tRNA synthetase along with tRNA and 5-fluoro-l,3-dihydro-l-hydroxy-2,l-benzoxaborole. Alternatively or additionally, the crystal has the three dimensional atomic coordinates of FIG. 3. An advantageous feature of the structural data according to FIG. 3 are that they have a high resolution of about 1.55 angstroms.

[0005] The coordinates of FIG. 1 and/or FIG. 3 provide a measure of atomic location in Angstroms, to a first decimal place. The coordinates are a relative set of positions that define a shape in three dimensions. It is possible that an entirely different set of coordinates having a different origin and/or axes could define a similar or identical shape. Furthermore, varying the relative atomic positions of the atoms of the structure so that the root mean square deviation of the conserved residue backbone atoms (i.e. the nitrogen- carbon-carbon backbone atoms of the protein amino acid residues) is less than 1.5 angstroms (preferably less than 1.0 angstroms and more preferably less than 0.5 angstroms) when superimposed on the coordinates provided in Table 1 for the conserved residue backbone atoms, will generally result in a structure which is substantially the same as the structure of FIG. 1 and/or FIG. 3 in terms of both its structural characteristics and potency for structure-based drug design of leucine tRNA synthetase inhibitors. Likewise changing the number and/or positions of the water molecules of FIG. 1 and/or FIG. 3 will not generally affect the potency of the structure for structure-based drug design of leucine tRNA synthetase inhibitors. Thus for the purposes described herein as being aspects of the present invention, it is within the scope of the invention if: the FIG. 1 and/or FIG. 3 coordinates are transposed to a different origin and/or axes; the relative atomic positions of the atoms of the structure are varied so that the root mean square deviation of conserved residue backbone atoms is less than 1.5 angstroms (preferably less than 1.0 angstroms and more preferably less than 0.5 angstroms) when superimposed on the coordinates provided in FIG. 1 and/or FIG. 3 for the conserved residue backbone atoms; and/or the number and/or positions of water molecules is varied. Reference herein to the coordinates of FIG. 1 and/or FIG. 3 thus includes the coordinates in which one or more individual values of the Figures are varied in this way.

[0006] Also, modifications in the leucine tRNA synthetase crystal structure due to e.g. mutations, additions, substitutions, and/or deletions of amino acid residues (including the deletion of one or more tetramer subunits) could account for variations in the leucine tRNA synthetase atomic coordinates. However, atomic coordinate data of leucine tRNA synthetase modified so that a ligand that bound to the editing domain of leucine tRNA synthetase would also be expected to bind to the corresponding binding sites of the modified leucine tRNA synthetase are, for the purposes described herein as being aspects of the present invention, also within the scope of the invention. Reference herein to the coordinates of FIG. 1 and/or FIG. 3 thus includes the coordinates modified in this way. Preferably, the modified coordinate data define at least one leucine tRNA synthetase editing domain.

[0007] In a fourth aspect, the invention provides a method of testing a candidate agent compound (such as a candidate inhibitor of leucine tRNA synthetase) for ability to modulate leucine tRNA synthetase editing domain activity comprising the step of contacting the candidate agent compound with leucine tRNA synthetase to determine the ability of the candidate agent compound to interact with the editing domain of leucine tRNA synthetase.

[0008] Preferably, the candidate agent compound is contacted with leucine tRNA synthetase in the presence of tRNA or a compound which comprises an adenosine molecule with hydroxyl moieties at the 2' and 3' positions, and typically a buffer.

[0009] In a fifth aspect, the invention provides a method of analysing a leucine tRNA synthetase -ligand complex comprising the step of employing (i) X-ray crystallographic diffraction data from the leucine tRNA synthetase -ligand complex and (ii) a three- dimensional structure of leucine tRNA synthetase, to generate a difference Fourier electron density map of the complex, the three-dimensional structure being defined by atomic coordinate data according to FIG. 1 and/or FIG. 3.

[0010] Electron density maps can be calculated using programs such as those from the CCP4 computing package (Acta Crystallographica, D50, (1994), 760-763.). For map visualisation and model building programs such as O (Jones et al, Acta Crystallograhy, A47, (1991), 110-119) can be used.

[0011] In a sixth aspect, the invention provides a method of identifying an agent compound (such as an inhibitor of leucine tRNA synthetase) which modulates leucine tRNA synthetase editing domain activity comprising the steps of: a) providing a candidate agent compound; b) forming a complex of leucine tRNA synthetase (produced e.g. according to the method of the invention) and the candidate agent compound; and c) analysing said complex by X-ray crystallography (e.g. according to a method of the invention) or by NMR spectroscopy to determine the ability of said candidate agent compound to interact with leucine tRNA synthetase. Detailed structural information can then be obtained about the binding of the agent compound to the editing domain of leucine tRNA synthetase, and in the light of this information adjustments can be made to the structure or functionality of the agent compound, e.g. to improve binding to the editing domain. Steps b) and c) may be repeated and re-repeated as necessary. For X-ray crystallographic analysis, the complex may be formed by crystal soaking or co- crystallisation.

[0012] In a seventh aspect, the present invention provides a method of identifying an agent compound (such as an inhibitor of leucine tRNA synthetase) which modulates leucine tRNA synthetase editing domain activity, comprising the steps of: a) providing a model of an editing domain of leucine tRNA synthetase, said model including the editing domain binding site as described in FIG. 1 and/or FIG. 3; b) providing the structure of a candidate agent compound; c) fitting the candidate agent compound to said editing domain, including determining the interactions between the candidate agent compound and at least one (and preferably both) of editing domain binding sites; and d) selecting the fitted candidate agent compound.

[0013] Without wishing to be held to any particular theory, we believe that, in the appropriate context (e.g. in the complexes described below in the "Detailed Description of the Invention"), the editing domain binding site as described in FIG. 1 and/or FIG. 3 provides the corresponding binding interaction of the editing domain to an agent compound. However, the binding interactions the editing domains of FIG. 1 and/or FIG. 3 are not intended to be exhaustive, and it is within the scope of this aspect of the invention that any of the binding sites may exhibit an interaction which is not listed in FIG. l and/or FIG. 3.

[0014] The modeling may include generating the editing domain (and optionally the agent compound) on a computer screen for visual inspection.

[0015] In practice, it is desirable to model a sufficient number of atoms of the leucine tRNA synthetase as defined by the coordinates of FIG. 1 and/or FIG. 3. Thus, in this aspect of the invention, there will preferably be provided the coordinates of at least 5, preferably at least 10, more preferably at least 50 and even more preferably at least 100 atoms of the leucine tRNA synthetase structure.

[0016] In practice, it is desirable to model a sufficient number of atoms of the leucine tRNA as partially described in FIG. 3. Thus, in this aspect of the invention, there will preferably be provided the coordinates of at least 5, preferably at least 10, more preferably at least 50 and even more preferably at least 100 atoms of the leucine tRNA structure.

[0017] Preferred candidate agent compounds bind with at least two, three, four, five, six or seven residues of the editing domain binding pocket. In general, the agent compound binds better as the strength and number of binding interactions increases.

[0018] Binding interactions may be mediated by e.g. water or other solvent molecules.

[0019] Candidate inhibitors identified according to the method are characterised by their suitability for binding to particular residues in the editing domain, as well as the tRNA (or adenosine). The editing domain can therefore be regarded as a type of framework or negative template with which the candidate inhibitors correlate in the manner described above.

[0020] More specifically, a potential modulator of leucine tRNA synthetase editing domain activity can be examined through the use of computer modeling using a docking program such as GRAM, DOCK, or AUTODOCK (see Walters et al, Drug Discovery Today, Vol.3, No.4, (1998), 160-178, and Dunbrack et al, Folding and Design, 2, (1997), 27-42). This procedure can include computer fitting of candidate inhibitors to a leucine tRNA synthetase editing domain to ascertain how well the shape and the chemical structure of the candidate inhibitor will bind to the enzyme.

[0021] Computer programs can be employed to estimate the interactions between the leucine tRNA synthetase and the agent compound. The more specificity in the design of a candidate drug, the more likely it is that the drug will not interact with other proteins as well. This will tend to minimise side-effects due to unwanted interactions with other proteins.

[0022] Alternatively, step b) of the method may involve selecting the candidate agent compound by computationally screening a database of compounds for interaction with the editing domain. For example, the model resulting from step a) may be used to interrogate the compound database, a candidate inhibitor being a compound that has a good match to the features of the model. In effect, the model is a type of virtual pharmacophore.

[0023] Having determined possible candidate agent compounds, these can then be obtained or synthesised and screened for activity. Consequently, the method preferably comprises the further step of: e) contacting the candidate agent compound with leucine tRNA synthetase to determine the ability of the candidate agent compound to interact with leucine tRNA synthetase. In an exemplary embodiment, the method preferably comprises the further step of: f) contacting the candidate agent compound with leucine tRNA synthetase and a tRNA, such as leucine tRNA, to determine the ability of the candidate agent compound to interact with leucine tRNA synthetase. In an exemplary embodiment, the method preferably comprises the further step of: f) contacting the candidate agent compound with leucine tRNA synthetase and AMP, or an AMP analog, to determine the ability of the candidate agent compound to interact with leucine tRNA synthetase.

[0024] Preferably, in step e) the candidate agent compound is contacted with leucine tRNA synthetase in the presence of tRNA or a compound which comprises an adenosine molecule with hydroxyl moieties at the 2' and 3' positions, and typically a buffer.

[0025] Preferably, in step e) the candidate agent compound is contacted with leucine tRNA synthetase in the presence of AMP, or an AMP analog, or a compound which comprises an adenosine molecule with hydroxyl moieties at the 2' and 3' positions, and typically a buffer.

[0026] Instead of, or in addition to, performing a chemical assay, the method may comprise the further steps of: e) forming a complex of leucine tRNA synthetase and said candidate agent compound; and f) analysing said complex by X-ray crystallography (e.g. according to the method of the fourth aspect) or by NMR spectroscopy to determine the ability of said candidate agent compound to interact with leucine tRNA synthetase. Detailed structural information can then be obtained about the binding of the candidate agent compound to leucine tRNA synthetase, and in the light of this information adjustments can be made to the structure or functionality of the candidate agent compound, e.g. to improve binding to the editing domain. Steps e) and f) may then be repeated and re-repeated as necessary. For X-ray crystallographic analysis, the complex may be formed by crystal soaking or co-crystallisation. Preferably, in step e) the candidate agent compound is contacted with leucine tRNA synthetase in the presence of tRNA or a compound which comprises an adenosine molecule with hydroxyl moieties at the 2' and 3' positions, and typically a buffer.

[0027] In another aspect, the invention includes a compound which is identified as an agent compound (such as an inhibitor of leucine tRNA synthetase) for modulating leucine tRNA synthetase activity by the method of one of the previous aspects.

[0028] Following identification of an agent compound it may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a composition such as a medicament, pharmaceutical composition or drug. These may be administered to individuals.

[0029] Thus, the present invention extends in various aspects not only to an agent compound as provided by the invention, but also a pharmaceutical composition, medicament, drug or other composition comprising such an agent compound e.g. for treatment (which may include preventative treatment) of a disease such as a microbial infection; a method comprising administration of such a composition to a patient, e.g. for treatment of a disease such as a microbial infection; use of such an agent compound in the manufacture of a composition for administration, e.g. for treatment of a disease such as a microbial infection; and a method of making a pharmaceutical composition comprising admixing such an agent compound with a pharmaceutically acceptable excipient, vehicle or carrier, and optionally other ingredients.

[0030] In another aspect, the present invention provides a system, particularly a computer system, intended to generate structures and/or perform rational drug design for leucine tRNA synthetase or leucine tRNA synthetase-candidate agent or leucine tRNA synthetase-tRNA-candidate agent complexes, the system containing either (a) atomic coordinate data according to FIG. 1 and/or FIG. 3, said data comprising the three- dimensional structure of leucine tRNA synthetase, or (b) structure factor data for leucine tRNA synthetase, said structure factor data being derivable from the atomic coordinate data of FIG. 1 and/or FIG. 3.

[0031] In a further aspect, the present invention provides computer readable media with either (a) atomic coordinate data according to FIG. 1 and/or FIG. 3 recorded thereon, said data comprising the three-dimensional structure of leucine tRNA synthetase, or (b) structure factor data for leucine tRNA synthetase recorded thereon, the structure factor data being derivable from the atomic coordinate data of FIG. 1 and/or FIG. 3.

[0032] By providing such computer readable media, the atomic coordinate data can be routinely accessed to model fully-processed leucine tRNA synthetase. For example, RASMOL (Sayle et al, Trends in Biochemical Sciences, Vol. 20, (1995), 374) is a publicly available computer software package which allows access and analysis of atomic coordinate data for structure determination and/or rational drug design.

[0033] On the other hand, structure factor data, which are derivable from atomic coordinate data (see e.g. Blundell et al., Protein Crystallography, Academic Press, New York, London and San Francisco, (1976)), are particularly useful for calculating e.g. difference Fourier electron density maps.

[0034] By providing such computer readable media, the atomic coordinate data can be routinely accessed to model fully-processed leucine tRNA synthetase. For example, RASMOL (Sayle et al., Trends in Biochemical Sciences, Vol. 20, (1995), 374) is a publicly available computer software package which allows access and analysis of atomic coordinate data for structure determination and/or rational drug design.

[0035] On the other hand, structure factor data, which are derivable from atomic coordinate data (see e.g. Blundell et al., Protein Crystallography, Academic Press, New York, London and San Francisco, (1976)), are particularly useful for calculating e.g. difference Fourier electron density maps.

[0036] In an exemplary embodiment, the invention provides a co-crystal of a tRNA synthetase, a tRNA, and a candidate agent compound, wherein said candidate agent compound is bound to the editing domain of the leucine tRNA synthetase. In an exemplary embodiment, the candidate agent compound is bound to the editing domain. In an exemplary embodiment, the tRNA synthetase is a member selected from a mitochondrial tRNA synthetase and a cytoplasmic tRNA synthetase. In an exemplary embodiment, said tRNA synthetase is leucine tRNA synthetase. In an exemplary embodiment, said tRNA is leucine tRNA. In an exemplary embodiment, said candidate agent compound is a boron-containing compound. In an exemplary embodiment, said boron-containing compound is a member selected from an oxaborole and a cyclic boronic ester. In an exemplary embodiment, said boron-containing compound is 5-fluoro-l,3- dihydro-l-hydroxy-2,l-benzoxaborole. In an exemplary embodiment, said tRNA synthetase is obtained from a bacterial preparation. In an exemplary embodiment, said bacterial preparation is a culture of Thermus thermophilics.

[0037] In an exemplary embodiment, the invention provides a co-crystal of a tRNA synthetase, an adenosine monophosphate or analog thereof, and a candidate agent compound, wherein said candidate agent compound is bound to the editing domain of the leucine tRNA synthetase. In an exemplary embodiment, the candidate agent compound is bound to the editing domain. In an exemplary embodiment, the tRNA synthetase is a member selected from a mitochondrial tRNA synthetase and a cytoplasmic tRNA synthetase. In an exemplary embodiment, said tRNA synthetase is leucine tRNA synthetase. In an exemplary embodiment, said candidate agent compound is a boron- containing compound. In an exemplary embodiment, said boron-containing compound is a member selected from an oxaborole and a cyclic boronic ester. In an exemplary embodiment, said boron-containing compound is 5-fluoro-l,3-dihydro-l-hydroxy-2,l- benzoxaborole. In an exemplary embodiment, said tRNA synthetase is obtained from a bacterial preparation. In an exemplary embodiment, said bacterial preparation is a culture of Thermus thermophilics.

[0038] In another aspect, the invention is a method of developing an inhibitor for a tRNA synthetase in which the structure of said tRNA synthetase is unknown; said method comprising: a) comparing the sequence of said tRNA synthetase against the sequence of a second tRNA synthetase, wherein the structure of said second tRNA synthetase is known and an inhibitor of said second tRNA synthetase is known; b) fitting the structure of said tRNA synthetase to the structure of the second tRNA synthetase structure; c) comparing the interactions between said tRNA synthetase and the inhibitor of said second tRNA synthetase; d) altering the structure of the inhibitor in order to increase the binding interactions between said inhibitor and said tRNA synthetase, thereby developing said inhibitor.

[0039] In another aspect, the invention is a method of obtaining a co-crystal of leucine tRNA synthetase and a ligand by: generating a leucine tRNA synthetase/ 1,3 - dihydro-5-fluoro-l-hydroxy-2,l-benzoxaborole co-crystal; removing l,3-dihydro-5- fluoro-l-hydroxy-2,l-benzoxaborole from the co-crystal by soaking the crystal in a removal buffer; soaking the crystal in a soaking solution comprising the ligand.

[0040] In another aspect, the invention is a computer-based method for the analysis of the interaction of a molecular structure with a leucine tRNA synthetase structure, which comprises: providing the leucine tRNA synthetase structure or selected coordinates thereof; providing a molecular structure to be fitted to said leucine tRNA synthetase structure or selected coordinates thereof; and fitting the molecular structure to said leucine tRNA synthetase structure. In an exemplary embodiment, said leucine tRNA synthetase structure further comprises tRNAleu. In an exemplary embodiment, wherein said selected coordinates include atoms from one or more of the residues of the binding pocket of the editing domain. In an exemplary embodiment, the method further comprises modifying the molecular structure to change its interaction with one or more of the selected coordinates. In an exemplary embodiment, the method further comprises the steps of: obtaining or synthesising a compound which has said molecular structure; and contacting said compound with leucine tRNA synthetase to determine the ability of said compound to interact with said leucine tRNA synthetase. In an exemplary embodiment, the method further comprises the steps of: obtaining or synthesising a compound which has said molecular structure; forming a complex of a leucine tRNA synthetase and said compound; and analysing said complex by X-ray crystallography to determine the ability of said compound to interact with said leucine tRNA synthetase. [0041] In another aspect, the invention is a method for determining the structure of a compound bound to leucine tRNA synthetase, said method comprising: providing a crystal of leucine tRNA synthetase; soaking the crystal with the compound to form a complex; and determining the structure of the complex by employing the data of FIG. 1 and/or FIG. 3 or a portion thereof.

[0042] In another aspect, the invention is a method for determining the structure of a compound bound to leucine tRNA synthetase, said method comprising: mixing leucine tRNA synthetase with the compound; crystallising a leucine tRNA synthetase -compound complex; and determining the structure of the complex by employing the data of FIG. 1 and/or FIG. 3 or a portion thereof.

[0043] In another aspect, the invention is a computer-based method for the analysis of the interaction of two molecular structures within a leucine tRNA synthetase editing domain binding pocket, which comprises: providing the leucine tRNA synthetase structure of FIG. 1 and/or FIG. 3 or selected coordinates thereof which include coordinates of at least one of the residues of the editing domain; providing a first molecular structure to be fitted to said selected coordinates of residues of said region; fitting the first molecular structure to said leucine tRNA synthetase structure including at least one of the selected coordinates thereof; providing a second molecular structure; and fitting the second molecular structure to said leucine tRNA synthetase structure. In an exemplary embodiment, said first or second molecular structure fitted to the editing domain is a member selected from AMP, tRNA, tRNAleu, a boron-containing compound, and l,3-dihydro-5-fluoro-l-hydroxy-2,l-benzoxaborole. In an exemplary embodiment, the method further comprises modifying the structure fitted to said binding pocket of the editing domain.

[0044] In another aspect, the invention is a computer system, intended to generate structures and/or perform optimization of compounds which interact with leucine tRNA synthetase, leucine tRNA synthetase homologues or analogues, complexes of leucine tRNA synthetase with compounds, or complexes of leucine tRNA synthetase homologues or analogues with compounds, the system containing computer-readable data comprising one or more of: (a) atomic coordinate data according to FIG. 1 and/or FIG. 3, said data defining the three-dimensional structure of leucine t-RNA synthetase or at least selected coordinates thereof; (b) structure factor data for leucine tRNA synthetase, said structure factor data being derivable from the atomic coordinate data of FIG. 1 and/or FIG. 3; (c) atomic coordinate data of a target leucine tRNA synthetase protein generated by homology modeling of the target based on the data of FIG. 1 and/or FIG. 3; (d) atomic coordinate data of a target leucine tRNA synthetase protein generated by interpreting X-ray crystallographic data or NMR data by reference to the data of FIG. 1 and/or FIG. 3; and (e) structure factor data derivable from the atomic coordinate data of (c) or (d). In an exemplary embodiment, said atomic coordinate data is for at least one of the atoms of the binding pocket of the editing domain. In an exemplary embodiment, the methodcomprising: (i) a computer-readable data storage medium comprising data storage material encoded with said computer-readable data; (ii) a working memory for storing instructions for processing said computer-readable data; and (iii) a central-processing unit coupled to said working memory and to said computer-readable data storage medium for processing said computer-readable data and thereby generating structures and/or performing rational drug design. In an exemplary embodiment, the method further comprising a display coupled to said central-processing unit for displaying said structures.

[0045] In another aspect, the invention is a method of providing data for generating structures and/or performing optimisation of compounds which interact with leucine tRNA synthetase, leucine tRNA synthetase homologues or analogues, complexes of leucine tRNA synthetase with compounds, or complexes of leucine tRNA synthetase homologues or analogues with compounds, the method comprising:

(i) establishing communication with a remote device containing computer- readable data comprising at least one of:

(a) atomic coordinate data according to FIG. 1 and/or FIG. 3, said data defining the three-dimensional structure of leucine tRNA synthetase, or the coordinates of a plurality of atoms of leucine tRNA synthetase;

(b) structure factor data for leucine tRNA synthetase, said structure factor data being derivable from the atomic coordinate data of FIG. l and/or FIG. 3;

(c) atomic coordinate data of a target leucine tRNA synthetase homologue or analogue generated by homology modeling of the target based on the data of FIG. 1 and/or FIG. 3; (d) atomic coordinate data of a protein generated by interpreting

X-ray crystallographic data or NMR data by reference to the data of FIG. 1 and/or FIG. 3; and

(e) structure factor data derivable from the atomic coordinate data of (c) or (d); and (ii) receiving said computer-readable data from said remote device.

[0046] In another aspect, the invention provides a crystal comprising a bacterial leucyl tRNA synthetase, an adenosine-containing moiety; and a ligand, wherein said ligand interacts with the editing domain of the tRNA synthetase. In an exemplary embodiment, the crystal has a space group of P212121. In an exemplary embodiment, the crystal has a space group of P21. In an exemplary embodiment, the crystal has a space group of P212121. In an exemplary embodiment, the crystal has a space group of C2221. In an exemplary embodiment, the crystal has cell parameters of approximately a=101.83 A, b=154.23 A, c=174.95 A, and alpha=90.00, beta=90.00, gamma=90.00. In an exemplary embodiment, the crystal has a space group of C2. In an exemplary embodiment, the crystal has cell parameters of approximately a=202.05 A, b=125.80 A, c=173.20 A, and alpha=90.00, beta=l 18.71, gamma=90.00. In an exemplary embodiment, said ligand is bound to the editing domain. In an exemplary embodiment, said bacterial leucyl tRNA synthetase is a member selected from a mitochondrial tRNA synthetase and a cytoplasmic tRNA synthetase. In an exemplary embodiment, said bacterial leucyl tRNA synthetase has a sequence which is a member selected from the wild-type, homolog or mutant of a member selected from Acinetobacter spp., Bacteroides spp., Burkholderia spp., Enteric bacteria, Enterococcus spp., Pseudomonas spp., Haemophilus spp., Strepococcus spp., and Staphylococcus spp., Stenotrophomonas maltophilia, Clostridium difficile, Propionibacter acnes, Bacillus anthracis, Mycobacterium tuberculosis, Escheria CoIi and Thermus thermophilus . In an exemplary embodiment, said tRNA synthetase is obtained from a bacterial preparation. In an exemplary embodiment, said bacterial preparation is a culture of a member selected from Acinetobacter spp., Bacteroides spp., Burkholderia spp., Enteric bacteria, Enterococcus spp., Pseudomonas spp., Haemophilus spp., Strepococcus spp., and Staphylococcus spp., Stenotrophomonas maltophilia, Clostridium difficile, Propionibacter acnes, Bacillus anthracis, Mycobacterium tuberculosis, Escheria CoIi and Thermus thermophilus. In an exemplary embodiment, the ligand is a boron-containing compound. In an exemplary embodiment, said boron-containing compound is an oxaborole. In an exemplary embodiment, said boron-containing compound is a cyclic boronic ester. In an exemplary embodiment, said boron-containing compound has a structure according to the following formula:

wherein R1 is a member selected from a negative charge, a salt counterion, H, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; R3 and R4 are members independently selected from H, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; R9, R10, R11 and R12 are members independently selected from H, OR*, NR*R**, SR*, -S(O)R*, -S(O)2R*, -S(O)2NR*R**, -C(O)R*, -C(O)OR*, - C(0)NR*R**, nitro, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; wherein each R* and R** are members independently selected from H, nitro, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; R3 and R4, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring; R9 and R10, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring; R10 and R11, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring; and R11 and R12, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring. In an exemplary embodiment, the ligand is not Cl. In an exemplary embodiment, each R3 and R4 is a member independently selected from H, cyano, substituted or unsubstituted methyl, substituted or unsubstituted ethyl, trifluoromethyl, substituted or unsubstituted hydroxymethyl, substituted or unsubstituted hydroxyalkyl, substituted or unsubstituted benzyl, substituted or unsubstituted phenyl, substituted or unsubstituted mercaptomethyl, substituted or unsubstituted mercaptoalkyl, substituted or unsubstituted aminomethyl, substituted or unsubstituted alkylaminomethyl, substituted or unsubstituted dialkylaminomethyl, substituted or unsubstituted arylaminomethyl, substituted or unsubstituted indolyl and substituted or unsubstituted amido. In an exemplary embodiment, R3 is H and R4 is a member independently selected from cyano, substituted or unsubstituted methyl, substituted or unsubstituted ethyl, trifluoromethyl, substituted or unsubstituted hydroxymethyl, substituted or unsubstituted hydroxyalkyl, substituted or unsubstituted benzyl, substituted or unsubstituted phenyl, substituted or unsubstituted mercaptomethyl, substituted or unsubstituted mercaptoalkyl, substituted or unsubstituted aminomethyl, substituted or unsubstituted alkylaminomethyl, substituted or unsubstituted dialkylaminomethyl, substituted or unsubstituted arylaminomethyl, substituted or unsubstituted indolyl, substituted or unsubstituted amido. In an exemplary embodiment, R3 is H and R4 is substituted or unsubstituted aminomethyl. In an exemplary embodiment, R3 is H; R4 is H, and R9, R10, R11 and R12 are members independently selected from H, OR*, NR*R**, SR*, -S(O)R*, -S(O)2R*, -S(O)2NR*R**, -C(O)R*, - C(O)OR*, -C(O)NR*R**, halogen, cyano, nitro, substituted or unsubstituted methoxy, substituted or unsubstituted methyl, substituted or unsubstituted ethoxy, substituted or unsubstituted ethyl, trifluoromethyl, substituted or unsubstituted hydroxymethyl, substituted or unsubstituted hydroxyalkyl, substituted or unsubstituted benzyl, substituted or unsubstituted phenyl, substituted or unsubstituted phenyloxy, substituted or unsubstituted phenyl methoxy, substituted or unsubstituted thiophenyloxy, substituted or unsubstituted pyridinyloxy, substituted or unsubstituted pyrimidinyloxy, substituted or unsubstituted benzylfuran, substituted or unsubstituted methylthio, substituted or unsubstituted mercaptomethyl, substituted or unsubstituted mercaptoalkyl, substituted or unsubstituted phenylthio, substituted or unsubstituted thiophenylthio, substituted or unsubstituted phenyl methylthio, substituted or unsubstituted pyridinylthio, substituted or unsubstituted pyrimidinylthio, substituted or unsubstituted benzylthiofuranyl, substituted or unsubstituted phenylsulfonyl, substituted or unsubstituted benzylsulfonyl, substituted or unsubstituted phenylmethylsulfonyl, substituted or unsubstituted thiophenylsulfonyl, substituted or unsubstituted pyridinylsulfonyl, substituted or unsubstituted pyrimidinylsulfonyl, substituted or unsubstituted sulfonamidyl, substituted or unsubstituted phenylsulfmyl, substituted or unsubstituted benzylsulfmyl, substituted or unsubstituted phenylmethylsulfmyl, substituted or unsubstituted thiophenylsulfmyl, substituted or unsubstituted pyridinylsulfϊnyl, substituted or unsubstituted pyrimidinylsulfmyl, substituted or unsubstituted amino, substituted or unsubstituted alkylamino, substituted or unsubstituted dialkylamino, substituted or unsubstituted trifluoromethylamino, substituted or unsubstituted aminomethyl, substituted or unsubstituted alkylaminomethyl, substituted or unsubstituted dialkylaminomethyl, substituted or unsubstituted arylaminomethyl, substituted or unsubstituted benzylamino, substituted or unsubstituted phenylamino, substituted or unsubstituted thiophenylamino, substituted or unsubstituted pyridinylamino, substituted or unsubstituted pyrimidinylamino, substituted or unsubstituted indolyl, substituted or unsubstituted morpholino, substituted or unsubstituted alkylamido, substituted or unsubstituted arylamido, substituted or unsubstituted ureido, substituted or unsubstituted carbamoyl, and substituted or unsubstituted piperizinyl. In an exemplary embodiment, said boron- containing compound is a member selected from Cl, C2, C3, C4, C5, C6, C7 and C8. In an exemplary embodiment, said adenosine-containing moiety has a structure which is a member selected from:

wherein L is substituted or unsubstituted adenine; A is a member selected from OH, substituted or unsubstituted monophosphate, substituted or unsubstituted diphosphate,

O

substituted or unsubstituted triphosphate, A1- O- ; and

wherein Al is a nucleic acid sequence which comprises between 1 and 200 nucleotides. In an exemplary embodiment, said Al is a nucleic acid sequence which is a leucyl tRNA or a portion of a leucyl tRNA. In an exemplary embodiment, said Al is a nucleic acid sequence which is a leucyl tRNA or a portion of a leucyl tRNA of a member selected from Acinetobacter spp., Bacteroides spp., Burkholderia spp., Enteric bacteria, Enterococcus spp., Pseudomonas spp., Haemophilus spp., Strepococcus spp., and Staphylococcus spp., Stenotrophomonas maltophilia, Clostridium difficile, Propionibacter acnes, Bacillus anthracis, Mycobacterium tuberculosis, Escheria CoIi and Thermus thermophilus.

[0047] A method of identifying a ligand for a bacterial leucyl tRNA synthetase, said method comprising: a) providing a model comprising an editing domain of said bacterial leucyl tRNA synthetase; b) providing the structure of the ligand and c) fitting the ligand to said editing domain, including determining the interactions between the ligand and at least one of said binding sites; d) selecting the fitted ligand, thereby identifying the ligand for said bacterial leucyl tRNA synthetase. In an exemplary embodiment, the method further comprises bl) providing the structure of an adenosine-containing moiety, and step c) comprises fitting the ligand and adenosine-containing moiety to said editing domain. In an exemplary embodiment, the ligand is not Cl. In an exemplary embodiment, said ligand is a boron-containing compound. In an exemplary embodiment, said boron- containing compound has a structure according to the following formula:

wherein R1 is a member selected from a negative charge, a salt counterion, H, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; R3 and R4 are members independently selected from H, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; R9, R10, R11 and R12 are members independently selected from H, OR*, NR=15R**, SR*, -S(O)R*, -S(O)2R*, -S(O)2NR*R**, -C(O)R*, -C(O)OR*, - C(O)NR*R**, nitro, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; wherein each R* and R** are members independently selected from H, nitro, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; R3 and R4, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring; R9 and R10, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring; R10 and R11, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring; and R11 and R12, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring. In an exemplary embodiment, wherein said boron-containing compound is a member selected from: Cl, C2, C3, C4, C5, C6, C7 and C8.

[0048] A method of identifying a ligand for a bacterial leucyl tRNA synthetase in which the structure of said bacterial leucyl tRNA synthetase is unknown; said method comprising: a) comparing the sequence of said bacterial leucyl tRNA synthetase against the sequence of a second leucyl tRNA synthetase, wherein the structure of said second leucyl tRNA synthetase is known and a ligand of said second leucyl tRNA synthetase is known; b) fitting the structure of said bacterial leucyl tRNA synthetase to the structure of the second leucyl tRNA synthetase; c) comparing the interactions between said bacterial leucyl tRNA synthetase and the ligand of said second leucyl tRNA synthetase; d) altering the structure of the ligand in order to increase the binding interactions between said ligand and said tRNA synthetase, thereby identifying said ligand. In an exemplary embodiment, the ligand is not Cl. In an exemplary embodiment, said ligand is a boron-containing compound. In an exemplary embodiment, said boron-containing compound has a structure according to the following formula:

wherein R1 is a member selected from a negative charge, a salt counterion, H, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; R3 and R4 are members independently selected from H, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; R9, R10, R11 and R12 are members independently selected from H, OR*, NR*R**, SR*, -S(O)R*, -S(O)2R*, -S(O)2NR*R**, -C(O)R*, -C(O)OR*, - C(O)NR*R**, nitro, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; wherein each R* and R** are members independently selected from H, nitro, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; R3 and R4, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring; R9 and R10, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring; R10 and R11, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring; and R11 and R12, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring. In an exemplary embodiment, n said boron-containing compound is a member selected from Cl, C2, C3, C4, C5, C6, C7 and C8.

[0049] A computer-based method for the analysis of the interaction of a ligand structure with a bacterial leucyl tRNA synthetase structure, which comprises: providing the bacterial leucyl tRNA synthetase structure or selected coordinates thereof; providing a ligand structure to be fitted to said bacterial leucyl tRNA synthetase structure or selected coordinates thereof; and fitting the ligand structure to said bacterial leucyl tRNA synthetase structure. In an exemplary embodiment, the ligand is not Cl. In an exemplary embodiment, further comprising: providing an adenosine-containing moiety structure to be fitted to said bacterial leucyl tRNA synthetase structure or selected coordinates thereof. In an exemplary embodiment, wherein said bacterial leucyl tRNA synthetase selected coordinates include atoms from one or more of the residues of the binding pocket of the editing domain. In an exemplary embodiment, which further comprises modifying the ligand structure to change its interaction with one or more of the bacterial leucyl tRNA synthetase selected coordinates. In an exemplary embodiment, which further comprises the steps of: obtaining or synthesising a ligand which has said ligand structure; and contacting said ligand with a bacterial leucyl tRNA synthetase to determine the ability of said ligand to interact with said bacterial leucyl tRNA synthetase. In an exemplary embodiment, further comprises the steps of: obtaining or synthesising a ligand which has said ligand structure; obtaining or synthesising an adenosine-containing moiety which has said adenosine-containing moiety structure; forming a complex of a bacterial leucyl tRNA synthetase and said ligand and said adenosine-containing moiety; and analysing said complex by X-ray crystallography to determine the ability of said ligand to interact with said bacterial leucyl tRNA synthetase.

[0050] A method for determining the structure of a ligand bound to bacterial leucyl tRNA synthetase, said method comprising: providing a crystal of bacterial leucyl tRNA synthetase; soaking the crystal with a ligand and an adenosine-containing moiety to form a complex; and determining the structure of the complex by employing the X-ray structure data (atomic structure data, etc.) provided herein a portion thereof. In an exemplary embodiment, the X-ray data is a member selected from FIG. 1 or FIG. 3. In an exemplary embodiment, the ligand is not Cl.

[0051] A method for determining the structure of a ligand bound to bacterial leucyl tRNA synthetase, said method comprising: mixing bacterial leucyl tRNA synthetase with the ligand and an adenosine-containing moiety; crystallising a leucyl tRNA synthetase/adenosine-containing moiety/ligand complex; and determining the structure of the complex by employing the X-ray structure data (atomic structure data, etc.) or a portion thereof. In an exemplary embodiment, the ligand is not Cl. In an exemplary embodiment, the X-ray data is a member selected from FIG. 1 or FIG. 3.

[0052] A computer-based method for the analysis of the interaction of two ligands within a bacterial leucyl tRNA synthetase editing domain binding pocket, which comprises: providing the bacterial leucyl tRNA synthetase structure described herein or selected coordinates thereof which include coordinates of at least one of the residues of the editing domain; providing a first ligand structure to be fitted to said selected coordinates of residues of said region; fitting the first ligand structure to said bacterial leucyl tRNA synthetase structure including at least one of the selected coordinates thereof; providing a second ligand structure; and fitting the second ligand structure to said leucyl tRNA synthetase structure. In an exemplary embodiment, the ligand is not Cl. In an exemplary embodiment, said first or second ligand structure fitted to the editing domain is a member selected from adenosine, adenosine-containing moiety, tRNAleu, a boron-containing compound, and 5-fluoro-l,3-dihydro-l-hydroxy-2,l-benzoxaborole. In an exemplary embodiment, which further comprises modifying the ligand structure fitted to said binding pocket of the editing domain. In an exemplary embodiment, the X-ray data is a member selected from FIG. 1 or FIG. 3.

[0053] A computer system, intended to generate structures and/or perform optimization of compounds which interact with bacterial leucyl tRNA synthetase, bacterial leucyl tRNA synthetase homo logs or analogs, complexes of bacterial leucyl tRNA synthetase with a ligand, or complexes of bacterial leucyl tRNA synthetase homo logs or analogs with a ligand, the system containing computer-readable data comprising one or more of: (a) X-ray data described herein, said data defining the three-dimensional structure of bacterial leucyl t-RNA synthetase or at least selected coordinates thereof; (b) structure factor data for bacterial leucyl tRNA synthetase, said structure factor data being derivable from the X-ray data described herein; (c) atomic coordinate data of a target bacterial leucyl tRNA synthetase protein generated by homology modeling of the target based on the X-ray data described herein; (d) atomic coordinate data of a target bacterial leucyl tRNA synthetase protein generated by interpreting X-ray crystallographic data or NMR data by reference to the X-ray data described herein; and (e) structure factor data derivable from the atomic coordinate data of (c) or (d). In an exemplary embodiment, the ligand is not Cl. In an exemplary embodiment, said atomic coordinate data is for at least one of the atoms of the binding pocket of the editing domain. In an exemplary embodiment, comprising: (i) a computer-readable data storage medium comprising data storage material encoded with said computer-readable data; (ii) a working memory for storing instructions for processing said computer-readable data; and (iii) a central- processing unit coupled to said working memory and to said computer-readable data storage medium for processing said computer-readable data and thereby generating structures and/or performing rational drug design. In an exemplary embodiment, further comprising a display coupled to said central-processing unit for displaying said structures. In an exemplary embodiment, the X-ray data is a member selected from FIG. 1 or FIG. 3.

[0054] A method of providing data for generating ligand structures and/or performing optimisation of ligands which interact with bacterial leucyl tRNA synthetase, bacterial leucyl tRNA synthetase homo logs or analogs, complexes of bacterial leucyl tRNA synthetase with a ligand, or complexes of bacterial leucyl tRNA synthetase homo logs or analogs with a ligand, the method comprising: (i) establishing communication with a remote device containing computer-readable data comprising at least one of: (a) X-ray data described herein, said data defining the three-dimensional structure of bacterial leucyl tRNA synthetase, or the coordinates of a plurality of atoms of bacterial leucyl tRNA synthetase; (b) structure factor data for bacterial leucyl tRNA synthetase, said structure factor data being derivable from the X-ray data described herein; (c) atomic coordinate data of a target bacterial leucyl tRNA synthetase homolog or analog generated by homology modeling of the target based on the X-ray data described herein; (d) atomic coordinate data of a protein generated by interpreting X-ray crystallographic data or NMR data by reference to the X-ray data described herein; and (e) structure factor data derivable from the atomic coordinate data of (c) or (d); and (ii) receiving said computer- readable data from said remote device. In an exemplary embodiment, the ligand is not Cl. In an exemplary embodiment, the X-ray data is a member selected from FIG. 1 or FIG. 3.

BRIEF DESCRIPTION OF THE DRAWINGS

[0055] FIG. 1 shows atomic structure data for a complex of T. Thermophilus leucine tRNA synthetase, adenosine monophosphate (AMP) and 5-fluoro-l,3-dihydro-l-hydroxy- 2,1-benzoxaborole. The atomic coordinates provided are for orthogonal, right-handed axes. The following data list provides: Column 2: Atom no.; Column 3: Atom type; Column 4: Residue type; Column 5: Tetramer subunit; Column 6: Residue no.; Column 7: x coordinate of atom (angstroms); Column 8: y coordinate of atom (angstroms); Column 9: z coordinate of atom (angstroms); Column 10: Occupancy; Column 11 : B-factor (angstroms2). N. B. For water molecules, column 4 reads "WAT", column 5 reads G or H, column 6 is the no. of the water molecule, and the atomic coordinates of columns 7-9 are the coordinates of the water oxygen atoms.

[0056] FIG. 2 shows additional crystallographic data for the complex of FIG. 1.

[0057] FIG. 3 shows atomic structure data for a complex of T. Thermophilus leucine tRNA synthetase, tRNAleu and 5-fluoro-l,3-dihydro-l-hydroxy-2,l-benzoxaborole. The atomic coordinates provided are for orthogonal, right-handed axes. The following data list provides: Column 2: Atom no.; Column 3 : Atom type; Column 4: Residue type; Column 5: Tetramer subunit; Column 6: Residue no.; Column 7: x coordinate of atom (angstroms); Column 8: y coordinate of atom (angstroms); Column 9: z coordinate of atom (angstroms); Column 10: Occupancy; Column 11 : B-factor (angstroms2). N.B. For water molecules, column 4 reads "WAT", column 5 reads G or H, column 6 is the no. of the water molecule, and the atomic coordinates of columns 7-9 are the coordinates of the water oxygen atoms.

[0058] FIG. 4 shows additional crystallographic data for the complex of FIG. 3.

[0059] FIG. 5 shows that Cl is bound to the cis-diols of the last nucleotide of the tRNA in the editing site.

[0060] FIG. 6 shows the proposed mechanism of action of inhibition of leucine tRNA synthetase (LeuRS).

[0061] FIG. 7 shows the proposed mechanism of action of inhibition of leucine tRNA synthetase. Here, the tRNA first binds to LeuRS.

[0062] FIG. 8 shows the proposed mechanism of action of inhibition of leucine tRNA synthetase. Here, the 3' end of tRNA visits the editing and synthetic sites of LeuRS.

[0063] FIG. 9 shows the proposed mechanism of action of inhibition of leucine tRNA synthetase. Here, Cl binds to the editing site occupied by tRNA.

[0064] FIG. 10 shows the proposed mechanism of action of inhibition of leucine tRNA synthetase. Here, the tRNA is trapped in the editing site by Cl preventing synthesis of Leu-tRNAleu.

[0065] FIG. ll a) shows a three-dimensional representation of the interactions between C2, tRNAleu and E. CoIi LeuRS. b) shows a two-dimensional representation of the interactions between C2, tRNAleu and E. CoIi LeuRS. c) shows atomic structure data for a complex of E. CoIi leucine tRNA synthetase, tRNAleu and C2.

[0066] FIG. 12 a) shows a three-dimensional representation of the interactions between C3, tRNAleu and E. CoIi LeuRS. b) shows a two-dimensional representation of the interactions between C3, tRNAleu and E. CoIi LeuRS. c) shows atomic structure data for a complex of E. CoIi leucine tRNA synthetase, tRNAleu and C3.

[0067] FIG. 13 a) shows a three-dimensional representation of the interactions between C4, tRNAleu and E. CoIi LeuRS. b) shows a two-dimensional representation of the interactions between C4, tRNAleu and E. CoIi LeuRS. c) shows atomic structure data for a complex of E. CoIi leucine tRNA synthetase, tRNAleu and C4. [0068] FIG. 14 a) shows a three-dimensional representation of the interactions between C5, tRNAleu and E. CoIi LeuRS. b) shows a two-dimensional representation of the interactions between C5, tRNAleu and E. CoIi LeuRS. c) shows atomic structure data for a complex of E. CoIi leucine tRNA synthetase, tRNAleu and C5.

[0069] FIG. 15 a) shows a three-dimensional representation of the interactions between C6, tRNAleu and E. CoIi LeuRS. b) shows a two-dimensional representation of the interactions between C6, tRNAleu and E. CoIi LeuRS. c) shows atomic structure data for a complex of E. CoIi leucine tRNA synthetase, tRNAleu and C6.

[0070] FIG. 16 a) shows a three-dimensional representation of the interactions between C7, tRNAleu and E. CoIi LeuRS. b) shows a two-dimensional representation of the interactions between C7, tRNAleu and E. CoIi LeuRS. c) shows atomic structure data for a complex of E. CoIi leucine tRNA synthetase, tRNAleu and C7.

DETAILED DESCRIPTION OF THE INVENTION

Definitions and Abbreviations

[0071] The abbreviations used herein generally have their conventional meaning within the chemical and biological arts.

[0072] Specific residues are denoted herein by their conventional acronyms (e.g. GIy for glycine), and numbers corresponding to their position in the unprocessed n-chain counting from the N-terminal of the n-chain (e.g. Gly24). Moreover, because each editing domain is formed from the residues of two n-chains, each residue is further denoted by a letter corresponding to the respective one of the n-chains (e.g. Gly24A or Lys9D). Below, we have used D and A to denote the two n-chains of a editing domain, but in a tetramer with four equivalent binding cavities and subunits labelled A, B, C and D one could equally use A and B, B and C, or C and D instead.

[0073] The term "binding site" as used herein means a site, such as an atom or functional group of an amino acid residue, in the ADC editing domain which may bind to an agent compound such as a candidate inhibitor. Depending on the particular molecule in the cavity, sites may exhibit attractive or repulsive binding interactions, brought about by charge, steric considerations and the like.

[0074] The term "fitting" as used herein means determining by automatic, or semiautomatic means, interactions between one or more atoms of an agent molecule and one or more atoms or binding sites of leucine tRNA synthetase, and determining the extent to which such interactions are stable. Various computer-based methods for fitting are described further herein.

[0075] The term "root mean square deviation" as used herein, means the square root of the arithmetic mean of the squares of the deviations from the mean.

[0076] The term "computer system" as used herein, means the hardware means, software means and data storage means used to analyse atomic coordinate data. The minimum hardware means of the computer-based systems of the present invention comprises a central processing unit (CPU), input means, output means and data storage means. Desirably a monitor is provided to visualise structure data. The data storage means may be RAM or means for accessing computer readable media of the invention. Examples of such systems are microcomputer workstations available from Silicon Graphics Incorporated and Sun Microsystems running Unix based, Windows NT or IBM OS/2 operating systems.

[0077] The term "computer readable media" as used herein, means any media which can be read and accessed directly by a computer e.g. so that the media is suitable for use in the above-mentioned computer system. The media include, but are not limited to: magnetic storage media such as floppy discs, hard disc storage medium and magnetic tape; optical storage media such as optical discs or CD-ROM; electrical storage media such as RAM and ROM; and hybrids of these categories such as magnetic/optical storage media.

[0078] The abbreviations used herein generally have their conventional meaning within the chemical and biological arts.

[0079] "Compound of the invention" and "exemplary compounds of use in methods of the invention," are used interchangeably and refer to the compounds discussed herein, and pharmaceutically acceptable salts and prodrugs of these compounds.

[0080] Where substituent groups are specified by their conventional chemical formulae, written from left to right, they equally encompass the chemically identical substituents, which would result from writing the structure from right to left, e.g., -CH2O- is intended to also recite -OCH2-. [0081] The term "poly" as used herein means at least 2. For example, a polyvalent metal ion is a metal ion having a valency of at least 2.

[0082] "Moiety" refers to the radical of a molecule that is attached to another moiety.

[0083] The symbol VΛ/WΛ S whether utilized as a bond or displayed perpendicular to a bond, indicates the point at which the displayed moiety is attached to the remainder of the molecule.

[0084] The term "alkyl," by itself or as part of another substituent, means, unless otherwise stated, a straight or branched chain, or cyclic hydrocarbon radical, or combination thereof, which may be fully saturated, mono- or polyunsaturated and can include di- and multivalent radicals, having the number of carbon atoms designated (i.e. Ci-Cio means one to ten carbons). Examples of saturated hydrocarbon radicals include, but are not limited to, groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, cyclohexyl, (cyclohexyl)methyl, cyclopropylmethyl, homologs and isomers of, for example, n-pentyl, n-hexyl, n-heptyl, n-octyl, and the like. An unsaturated alkyl group is one having one or more double bonds or triple bonds. Examples of unsaturated alkyl groups include, but are not limited to, vinyl, 2-propenyl, crotyl, 2- isopentenyl, 2-(butadienyl), 2,4-pentadienyl, 3-(l,4-pentadienyl), ethynyl, 1- and 3- propynyl, 3-butynyl, and the higher homologs and isomers. The term "alkyl," unless otherwise noted, is also meant to include those derivatives of alkyl defined in more detail below, such as "heteroalkyl." Alkyl groups that are limited to hydrocarbon groups are termed "homoalkyl".

[0085] The term "alkylene" by itself or as part of another substituent means a divalent radical derived from an alkane, as exemplified, but not limited, by -CH2CH2CH2CH2-, and further includes those groups described below as "heteroalkylene." Typically, an alkyl (or alkylene) group will have from 1 to 24 carbon atoms, with those groups having 10 or fewer carbon atoms being preferred in the present invention. A "lower alkyl" or "lower alkylene" is a shorter chain alkyl or alkylene group, generally having eight or fewer carbon atoms.

[0086] The terms "alkoxy," "alkylamino" and "alkylthio" (or thioalkoxy) are used in their conventional sense, and refer to those alkyl groups attached to the remainder of the molecule via an oxygen atom, an amino group, or a sulfur atom, respectively. [0087] The term "heteroalkyl," by itself or in combination with another term, means, unless otherwise stated, a stable straight or branched chain, or cyclic hydrocarbon radical, or combinations thereof, consisting of the stated number of carbon atoms and at least one heteroatom. In an exemplary embodiment, the heteroatoms can be selected from the group consisting of B, O, N and S, and wherein the nitrogen and sulfur atoms may optionally be oxidized and the nitrogen heteroatom may optionally be quaternized. The heteroatom(s) B, O, N and S may be placed at any interior position of the heteroalkyl group or at the position at which the alkyl group is attached to the remainder of the molecule. Examples include, but are not limited to, -CH2-CH2-O-CH3, -CH2-CH2-NH- CH3, -CH2-CH2-N(CHs)-CH3, -CH2-S-CH2-CH3, -CH2-CH2,-S(O)-CH3, -CH2-CH2- S(O)2-CH3, -CH=CH-O-CH3, -CH2-CH=N-OCH3, and -CH=CH-N(CH3)-CH3. Up to two heteroatoms may be consecutive, such as, for example, -CH2-NH-OCH3. Similarly, the term "heteroalkylene" by itself or as part of another substituent means a divalent radical derived from heteroalkyl, as exemplified, but not limited by, -CH2-CH2-S- CH2-CH2- and -CH2-S-CH2-CH2-NH-CH2-. For heteroalkylene groups, heteroatoms can also occupy either or both of the chain termini (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and the like). Still further, for alkylene and heteroalkylene linking groups, no orientation of the linking group is implied by the direction in which the formula of the linking group is written. For example, the formula - C(O)2R'- represents both -C(O)2R'- and -R5C(O)2-.

[0088] The terms "cycloalkyl" and "heterocycloalkyl", by themselves or in combination with other terms, represent, unless otherwise stated, cyclic versions of "alkyl" and "heteroalkyl", respectively. Additionally, for heterocycloalkyl, a heteroatom can occupy the position at which the heterocycle is attached to the remainder of the molecule. Examples of cycloalkyl include, but are not limited to, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl, cycloheptyl, and the like. Examples of heterocycloalkyl include, but are not limited to, 1 -(1,2,5,6-tetrahydropyridyl), 1- piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran- 2-yl, tetrahydrofuran-3-yl, tetrahydrothien-2-yl, tetrahydrothien-3-yl, 1 -piperazinyl, 2- piperazinyl, and the like.

[0089] The terms "halo" or "halogen," by themselves or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom. Additionally, terms such as "haloalkyl," are meant to include monohaloalkyl and polyhaloalkyl. For example, the term "halo(Ci-C4)alkyl" is mean to include, but not be limited to, trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl, and the like.

[0090] The term "aryl" means, unless otherwise stated, a polyunsaturated, aromatic, substituent that can be a single ring or multiple rings (preferably from 1 to 3 rings), which are fused together or linked covalently. The term "heteroaryl" refers to aryl groups (or rings) that contain from one to four heteroatoms. In an exemplary embodiment, the heteroatom is selected from B, N, O, and S, wherein the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen atom(s) are optionally quaternized. A heteroaryl group can be attached to the remainder of the molecule through a heteroatom. Non- limiting examples of aryl and heteroaryl groups include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, A- isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3- thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl, 2-quinoxalinyl, 5- quinoxalinyl, 3-quinolyl, and 6-quinolyl. Substituents for each of the above noted aryl and heteroaryl ring systems are selected from the group of acceptable substituents described below.

[0091] For brevity, the term "aryl" when used in combination with other terms {e.g. , aryloxy, arylthioxy, arylalkyl) includes both aryl and heteroaryl rings as defined above. Thus, the term "arylalkyl" is meant to include those radicals in which an aryl group is attached to an alkyl group (e.g. , benzyl, phenethyl, pyridylmethyl and the like) including those alkyl groups in which a carbon atom (e.g., a methylene group) has been replaced by, for example, an oxygen atom (e.g., phenoxymethyl, 2-pyridyloxymethyl, 3-(l- naphthyloxy)propyl, and the like).

[0092] Each of the above terms (e.g. , "alkyl," "heteroalkyl," "aryl" and "heteroaryl") are meant to include both substituted and unsubstituted forms of the indicated radical. Preferred substituents for each type of radical are provided below.

[0093] Substituents for the alkyl and heteroalkyl radicals (including those groups often referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) are generically referred to as "alkyl group substituents," and they can be one or more of a variety of groups selected from, but not limited to: -OR', =0, =NR\ =N-0R\ -NR'R", -SR', -halogen, -OC(O)R', - C(O)R', -CO2R', -CONR'R", -0C(0)NR'R", -NR"C(O)R', -NR'-C(0)NR"R"', - NR"C(0)2R', -NR-C(NR'R"R'")=NR"", -NR-C(NR'R")=NR'", -S(O)R', -S(O)2R', - S(O)2NR5R", -NRSO2R', -CN and -NO2 in a number ranging from zero to (2m'+l), where m' is the total number of carbon atoms in such radical. R', R", R'" and R"" each preferably independently refer to hydrogen, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, e.g., aryl substituted with 1-3 halogens, substituted or unsubstituted alkyl, alkoxy or thioalkoxy groups, or arylalkyl groups. When a compound of the invention includes more than one R group, for example, each of the R groups is independently selected as are each R', R", R'" and R"" groups when more than one of these groups is present. When R' and R" are attached to the same nitrogen atom, they can be combined with the nitrogen atom to form a 5-, 6-, or 7-membered ring. For example, - NR'R" is meant to include, but not be limited to, 1-pyrrolidinyl and 4-morpholinyl. From the above discussion of substituents, one of skill in the art will understand that the term "alkyl" is meant to include groups including carbon atoms bound to groups other than hydrogen groups, such as haloalkyl (e.g., -CF3 and -CH2CF3) and acyl (e.g., -C(O)CH3, - C(O)CF3, -C(O)CH2OCH3, and the like).

[0094] Similar to the substituents described for the alkyl radical, substituents for the aryl and heteroaryl groups are generically referred to as "aryl group substituents." The substituents are selected from, for example: halogen, -OR', =0, =NR', =N-0R', -NR'R", -SR', -halogen, -OC(O)R', -C(O)R', -CO2R', -CONR'R", -0C(0)NR'R", -NR"C(0)R', -NR'-C(0)NR"R"', -NR"C(0)2R', -NR-C(NR'R"R"')=NR"", -NR-C(NR'R")=NR'", - S(O)R', -S(O)2R', -S(O)2NR5R", -NRSO2R', -CN and -NO2, -R', -N3, -CH(Ph)2, fluoro(Ci-C4)alkoxy, and fluoro(Ci-C4)alkyl, in a number ranging from zero to the total number of open valences on the aromatic ring system; and where R', R", R'" and R"" are preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl. When a compound of the invention includes more than one R group, for example, each of the R groups is independently selected as are each R', R", R'" and R"" groups when more than one of these groups is present.

[0095] Two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -T-C(0)-(CRR')q-U-, wherein T and U are independently -NR-, -O-, -CRR'- or a single bond, and q is an integer of from 0 to 3. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -A-(CH2)I-B-, wherein A and B are independently -CRR'-, -O-, -NR-, -S-, -S(O)-, -S(O)2-, -S(O)2NR'- or a single bond, and r is an integer of from 1 to 4. One of the single bonds of the new ring so formed may optionally be replaced with a double bond. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -(CRR')s-X-(CR"R'")d-, where s and d are independently integers of from 0 to 3, and X is -O-, -NR'-, -S-, -S(O)-, -S(O)2-, or - S(O)2NR'-. The substituents R, R', R" and R'" are preferably independently selected from hydrogen or substituted or unsubstituted (Ci-C6)alkyl.

[0096] "Ring" as used herein means a substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. A ring includes fused ring moieties. The number of atoms in a ring is typically defined by the number of members in the ring. For example, a "5- to 7-membered ring" means there are 5 to 7 atoms in the encircling arrangement. The ring optionally included a heteroatom. Thus, the term "5- to 7- membered ring" includes, for example pyridinyl and piperidinyl. The term "ring" further includes a ring system comprising more than one "ring", wherein each "ring" is independently defined as above.

[0097] As used herein, the term "heteroatom" includes atoms other than carbon (C) and hydrogen (H). Examples include oxygen (O), nitrogen (N) sulfur (S), silicon (Si), germanium (Ge), aluminum (Al) and boron (B).

[0098] The symbol "R" is a general abbreviation that represents a substituent group that is selected from substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl and substituted or unsubstituted heterocycloalkyl groups.

[0099] By "effective" amount of a drug, formulation, or permeant is meant a sufficient amount of a active agent to provide the desired local or systemic effect. A "Topically effective," "Cosmetically effective," "pharmaceutically effective," or "therapeutically effective" amount refers to the amount of drug needed to effect the desired therapeutic result.

[0100] "Topically effective" refers to a material that, when applied to the skin, nail, hair, claw or hoof produces a desired pharmacological result either locally at the place of application or systemically as a result of transdermal passage of an active ingredient in the material.

[0101] "Cosmetically effective" refers to a material that, when applied to the skin, nail, hair, claw or hoof, produces a desired cosmetic result locally at the place of application of an active ingredient in the material.

[0102] The term "pharmaceutically acceptable salts" is meant to include salts of the compounds of the invention which are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds described herein. When compounds of the present invention contain relatively acidic functionalities, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in a suitable inert solvent. Examples of pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amino, or magnesium salt, or a similar salt. When compounds of the present invention contain relatively basic functionalities, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in a suitable inert solvent. Examples of pharmaceutically acceptable acid addition salts include those derived from inorganic acids like hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric, dihydrogenphosphoric, sulfuric, monohydrogensulfuric, hydriodic, or phosphorous acids and the like, as well as the salts derived from relatively nontoxic organic acids like acetic, propionic, isobutyric, maleic, malonic, benzoic, succinic, suberic, fumaric, lactic, mandelic, phthalic, benzenesulfonic, p-tolylsulfonic, citric, tartaric, methanesulfonic, and the like. Also included are salts of amino acids such as arginate and the like, and salts of organic acids like glucuronic or galactunoric acids and the like (see, for example, Berge et ah, Journal of Pharmaceutical Science 66: 1-19 (1977)). Certain specific compounds of the present invention contain both basic and acidic functionalities that allow the compounds to be converted into either base or acid addition salts. [0103] The neutral forms of the compounds are preferably regenerated by contacting the salt with a base or acid and isolating the parent compounds in the conventional manner. The parent form of the compound differs from the various salt forms in certain physical properties, such as solubility in polar solvents.

[0104] In addition to salt forms, the present invention provides compounds which are in a prodrug form. Prodrugs of the compounds or complexes described herein readily undergo chemical changes under physiological conditions to provide the compounds of the present invention. Additionally, prodrugs can be converted to the compounds of the present invention by chemical or biochemical methods in an ex vivo environment.

[0105] Certain compounds of the present invention can exist in unsolvated forms as well as solvated forms, including hydrated forms. In general, the solvated forms are equivalent to unsolvated forms and are encompassed within the scope of the present invention. Certain compounds of the present invention may exist in multiple crystalline or amorphous forms. In general, all physical forms are equivalent for the uses contemplated by the present invention and are intended to be within the scope of the present invention.

[0106] Certain compounds of the present invention possess asymmetric carbon atoms (optical centers) or double bonds; the racemates, diastereomers, geometric isomers and individual isomers are encompassed within the scope of the present invention.

[0107] The compounds of the present invention may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. For example, the compounds may be radiolabeled with radioactive isotopes, such as for example tritium (3H), iodine-125 (125I) or carbon-14 (14C). All isotopic variations of the compounds of the present invention, whether radioactive or not, are intended to be encompassed within the scope of the present invention.

[0108] The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable vehicle" refers to any formulation or carrier medium that provides the appropriate delivery of an effective amount of a active agent as defined herein, does not interfere with the effectiveness of the biological activity of the active agent, and that is sufficiently non-toxic to the host or patient. Representative carriers include water, oils, both vegetable and mineral, cream bases, lotion bases, ointment bases and the like. These bases include suspending agents, thickeners, penetration enhancers, and the like. Their formulation is well known to those in the art of cosmetics and topical pharmaceuticals. Additional information concerning carriers can be found in Remington: The Science and Practice of Pharmacy, 21st Ed., Lippincott, Williams & Wilkins (2005) which is incorporated herein by reference.

[0109] "Pharmaceutically acceptable topical carrier" and equivalent terms refer to pharmaceutically acceptable carriers, as described herein above, suitable for topical application. An inactive liquid or cream vehicle capable of suspending or dissolving the active agent(s), and having the properties of being nontoxic and non-inflammatory when applied to the skin, nail, hair, claw or hoof is an example of a pharmaceutically- acceptable topical carrier. This term is specifically intended to encompass carrier materials approved for use in topical cosmetics as well.

[0110] The term "pharmaceutically acceptable additive" refers to preservatives, antioxidants, fragrances, emulsifϊers, dyes and excipients known or used in the field of drug formulation and that do not unduly interfere with the effectiveness of the biological activity of the active agent, and that is sufficiently non-toxic to the host or patient. Additives for topical formulations are well-known in the art, and may be added to the topical composition, as long as they are pharmaceutically acceptable and not deleterious to the epithelial cells or their function. Further, they should not cause deterioration in the stability of the composition. For example, inert fillers, anti-irritants, tackifiers, excipients, fragrances, opacifiers, antioxidants, gelling agents, stabilizers, surfactant, emollients, coloring agents, preservatives, buffering agents, other permeation enhancers, and other conventional components of topical or transdermal delivery formulations as are known in the art.

[0111] The terms "enhancement," "penetration enhancement" or "permeation enhancement" relate to an increase in the permeability of the skin, nail, hair, claw or hoof to a drug, so as to increase the rate at which the drug permeates through the skin, nail, hair, claw or hoof. The enhanced permeation effected through the use of such enhancers can be observed, for example, by measuring the rate of diffusion of the drug through animal or human skin, nail, hair, claw or hoof using a diffusion cell apparatus. A diffusion cell is described by Merritt et al., J of Controlled Release, 1:161-162 (1984). The term "permeation enhancer" or "penetration enhancer" intends an agent or a mixture of agents, which, alone or in combination, act to increase the permeability of the skin, nail, hair or hoof to a drug.

[0112] The term "excipients" is conventionally known to mean carriers, diluents and/or vehicles used in formulating drug compositions effective for the desired use.

[0113] The term "topical administration" refers to the application of a pharmaceutical agent to the external surface of the skin, nail, hair, claw or hoof, such that the agent crosses the external surface of the skin, nail, hair, claw or hoof and enters the underlying tissues. Topical administration includes application of the composition to intact skin, nail, hair, claw or hoof, or to a broken, raw or open wound of skin, nail, hair, claw or hoof. Topical administration of a pharmaceutical agent can result in a limited distribution of the agent to the skin and surrounding tissues or, when the agent is removed from the treatment area by the bloodstream, can result in systemic distribution of the agent.

[0114] The term "transdermal delivery" refers to the diffusion of an agent across the barrier of the skin, nail, hair, claw or hoof resulting from topical administration or other application of a composition. The stratum corneum acts as a barrier and few pharmaceutical agents are able to penetrate intact skin. In contrast, the epidermis and dermis are permeable to many solutes and absorption of drugs therefore occurs more readily through skin, nail, hair, claw or hoof that is abraded or otherwise stripped of the stratum corneum to expose the epidermis. Transdermal delivery includes injection or other delivery through any portion of the skin, nail, hair, claw or hoof or mucous membrane and absorption or permeation through the remaining portion. Absorption through intact skin, nail, hair, claw or hoof can be enhanced by placing the active agent in an appropriate pharmaceutically acceptable vehicle before application to the skin, nail, hair, claw or hoof. Passive topical administration may consist of applying the active agent directly to the treatment site in combination with emollients or penetration enhancers. As used herein, transdermal delivery is intended to include delivery by permeation through or past the integument, i.e. skin, nail, hair, claw or hoof.

[0115] The term "microbial infection" refers to any infection of a host tissue by an infectious agent including, but not limited to, viruses, bacteria, mycobacteria, fungus and parasites (see, e.g., Harrison's Principles of Internal Medicine, pp. 93-98 (Wilson et al., eds., 12th ed. 1991); Williams et al, J. of Medicinal Chem. 42:1481-1485 (1999), herein each incorporated by reference in their entirety). [0116] "Biological medium," as used herein refers to both in vitro and in vivo biological milieus. Exemplary in vitro "biological media" include, but are not limited to, cell culture, tissue culture, homogenates, plasma and blood. In vivo applications are generally performed in mammals, preferably humans.

[0117] MIC, or minimum inhibitory concentration, is the point where compound stops more than 90% of cell growth relative to an untreated control.

[0118] "Inhibiting" and "blocking," are used interchangeably herein to refer to the partial or full blockade of an editing domain of a leucine tRNA synthetase.

[0119] The term "homolog", as used herein, means a protein having at least 30% amino acid sequence identity with a bacterial leucyl tRNA synthetase, or the editing domain thereof. Preferably the percentage identity will be 40, or 50%, more preferably 60 or 70% and most preferably 80 or 90%. A 95% identity is most particularly preferred.

[0120] The term "co-complex", as used herein, means the bacterial leucyl tRNA synthetase or a mutant or homolog of the bacterial leucyl tRNA synthetase in covalent or non-covalent association with a chemical entity or compound.

[0121] The term "mutant", as used herein, means the bacterial leucyl tRNA synthetase, i.e., a polypeptide displaying the biological activity of wild-type bacterial leucyl tRNA synthetase, characterized by the replacement of at least one amino acid from the wild-type bacterial leucyl tRNA synthetase sequence. Such a mutant may be prepared, for example, by expression of the bacterial leucyl tRNA synthetase cDNA previously altered in its coding sequence by oligonucleotide-directed mutagenesis.

[0122] The term "interacting with" refers to a condition of proximity between a ligand or compound, or portions thereof, and a bacterial leucyl tRNA synthetase or portions thereof (potentially including homo logs or mutants of the wild-type. The association may be non-covalent~wherein the juxtaposition is energetically favored by hydrogen bonding or van der Waals or electrostatic interactions—or it may be covalent.

/. Introduction

[0123] The present invention provides crystal structures which include a bacterial leucyl tRNA synthetase, a ligand, and an adenosine-containing moiety. Based on this structure and molecular models built using related proteins, these crystals provide ways to determining the most likely places to modify the ligand to take advantage of interactions with the bacterial leucyl tRNA synthetase and methods of identifying, improving or inhibiting the biological activity of the bacterial tRNA synthetase.

//. The Crystal Structure

[0124] The present invention is founded at least partly on the production of bacterial leucyl tRNA synthetase, the characterisation of the bacterial leucyl tRNA synthetase editing domain and its interactions with ligands and adenosine-containing moieties, such as tRNAleu, and the determination of a likely mechanism for inhibiting the enzyme.

[0125] In order to determine these mechanisms the structures of several bacterial leucyl tRNA synthetase/adenosine-containing moiety/ligand complexes were solved. The ligands which were studied included several boron-containing compounds. The adenosine-containing moieties included adenosine monophosphate (AMP), as well as a terminal portion of a tRNAleu. The structure of AMP and Cl complex is shown in FIG. 12. Since adenosine is often the only residue of the tRNAleu which interacts with Cl, the interactions between tRNAleu and Cl are largely the same as the cis-diol interaction between the AMP and Cl shown in FIG. 12.

//. a) Bacterial leucyl tRNA synthetase

[0126] The crystal structure of a bacterial leucyl tRNA synthetase with an adenosine- containing moiety and ligands associated with the synthetase's editing domain has been determined. Descriptions of the synthetase's purification and crystallization are described in the Examples section. The information derived from the crystal structure sheds light on how complexes with ligands may be formed that would alter the properties of the synthetase.

//. b) Lisand

[0127] A variety of ligands can be used in the compositions and methods described herein. In an exemplary embodiment, the ligand is any compound which is capable of interacting with the editing domain in the presence of an adenosine-containing moiety. In an exemplary embodiment, the ligand is a compound described herein. In an exemplary embodiment, the ligand is a boron-containing compound described herein. In an exemplary embodiment, there is the proviso that the ligand is not a naturally occuring- amino acid In an exemplary embodiment, the ligand is a boron-containing compound. In another exemplary embodiment, the ligand is an oxaborole or a cyclic boronic ester. In another exemplary embodiment, the ligand has a structure according to Formula I:

wherein B is boron. R1 is a member selected from a negative charge, a salt counterion, H, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. M is a member selected from oxygen, sulfur and NR2. R2 is a member selected from H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. J is a member selected from (CR3R4)n and CR5. R3, R4, and R5 are members independently selected from H, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. The index n is an integer selected from 0 to 2. W is a member selected from C=O (carbonyl), (CR6R7)m and CR8a. R6, R7, and R8 are members independently selected from H, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. The index m is an integer selected from 0 and 1. A is a member selected from CR9 and N. D is a member selected from CR10 and N. E is a member selected from CR11 and N. G is a member selected from CR12 and N. R9, R10, R11 and R12 are members independently selected from H, OR*, NR=15R**, SR*, -S(O)R*, -S(O)2R*, -S(O)2NR*R**, -C(O)R*, -C(O)OR*, - C(0)NR*R**, nitro, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. Each R* and R** are members independently selected from H, nitro, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. The combination of nitrogens (A + D + E + G) is an integer selected from 0 to 3. A member selected from R3, R4 and R5 and a member selected from R6, R7 and R8, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring. R3 and R4, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring. R6 and R7, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring. R9 and R10, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring. R10 and R11, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring. R11 and R12, together with the atoms to which they are attached, are optionally joined to form a 4 to 7 membered ring.

[0128] In an exemplary embodiment, the ligand has a structure according to Formula (II):

[0129] In another exemplary embodiment, each R3 and R4 is a member independently selected from H, cyano, substituted or unsubstituted methyl, substituted or unsubstituted ethyl, trifluoromethyl, substituted or unsubstituted hydroxymethyl, substituted or unsubstituted hydroxyalkyl, substituted or unsubstituted benzyl, substituted or unsubstituted phenyl, substituted or unsubstituted mercaptomethyl, substituted or unsubstituted mercaptoalkyl, substituted or unsubstituted aminomethyl, substituted or unsubstituted alkylaminomethyl, substituted or unsubstituted dialkylaminomethyl, substituted or unsubstituted arylaminomethyl, substituted or unsubstituted indolyl and substituted or unsubstituted amido. In another exemplary embodiment, each R3 and R4 is a member independently selected from cyano, substituted or unsubstituted methyl, substituted or unsubstituted ethyl, trifluoromethyl, substituted or unsubstituted hydroxymethyl, substituted or unsubstituted hydroxyalkyl, substituted or unsubstituted benzyl, substituted or unsubstituted phenyl, substituted or unsubstituted mercaptomethyl, substituted or unsubstituted mercaptoalkyl, substituted or unsubstituted aminomethyl, substituted or unsubstituted alkylaminomethyl, substituted or unsubstituted dialkylaminomethyl, substituted or unsubstituted arylaminomethyl, substituted or unsubstituted indolyl, substituted or unsubstituted amido. [0130] In another exemplary embodiment, each R3 and R4 is a member selected from H, substituted or unsubstituted methyl, substituted or unsubstituted ethyl, substituted or unsubstituted propyl, substituted or unsubstituted isopropyl, substituted or unsubstituted butyl, substituted or unsubstituted t-butyl, substituted or unsubstituted phenyl and substituted or unsubstituted benzyl. In another exemplary embodiment, R3 and R4 is a member selected from methyl, ethyl, propyl, isopropyl, butyl, t-butyl, phenyl and benzyl. In another exemplary embodiment, R3 is H and R4 is a member selected from methyl, ethyl, propyl, isopropyl, butyl, t-butyl, phenyl and benzyl. In another exemplary embodiment, R3 is H and R4 H.

[0131] In another exemplary embodiment, each R9, R10, R11 and R12 is a member independently selected from H, OR*, NR*R**, SR*, -S(O)R*, -S(O)2R*, -S(O)2NR*R**, -C(O)R*, -C(O)OR*, -C(O)NR*R**, halogen, cyano, nitro, substituted or unsubstituted methoxy, substituted or unsubstituted methyl, substituted or unsubstituted ethoxy, substituted or unsubstituted ethyl, trifluoromethyl, substituted or unsubstituted hydroxymethyl, substituted or unsubstituted hydroxyalkyl, substituted or unsubstituted benzyl, substituted or unsubstituted phenyl, substituted or unsubstituted phenyloxy, substituted or unsubstituted phenyl methoxy, substituted or unsubstituted thiophenyloxy, substituted or unsubstituted pyridinyloxy, substituted or unsubstituted pyrimidinyloxy, substituted or unsubstituted benzylfuran, substituted or unsubstituted methylthio, substituted or unsubstituted mercaptomethyl, substituted or unsubstituted mercaptoalkyl, substituted or unsubstituted phenylthio, substituted or unsubstituted thiophenylthio, substituted or unsubstituted phenyl methylthio, substituted or unsubstituted pyridinylthio, substituted or unsubstituted pyrimidinylthio, substituted or unsubstituted benzylthiofuranyl, substituted or unsubstituted phenylsulfonyl, substituted or unsubstituted benzylsulfonyl, substituted or unsubstituted phenylmethylsulfonyl, substituted or unsubstituted thiophenylsulfonyl, substituted or unsubstituted pyridinylsulfonyl, substituted or unsubstituted pyrimidinylsulfonyl, substituted or unsubstituted sulfonamidyl, substituted or unsubstituted phenylsulfmyl, substituted or unsubstituted benzylsulfϊnyl, substituted or unsubstituted phenylmethylsulfmyl, substituted or unsubstituted thiophenylsulfϊnyl, substituted or unsubstituted pyridinylsulfϊnyl, substituted or unsubstituted pyrimidinylsulfmyl, substituted or unsubstituted amino, substituted or unsubstituted alkylamino, substituted or unsubstituted dialkylamino, substituted or unsubstituted trifluoromethylamino, substituted or unsubstituted aminomethyl, substituted or unsubstituted alkylaminomethyl, substituted or unsubstituted dialkylaminomethyl, substituted or unsubstituted arylaminomethyl, substituted or unsubstituted benzylamino, substituted or unsubstituted phenylamino, substituted or unsubstituted thiophenylamino, substituted or unsubstituted pyridinylamino, substituted or unsubstituted pyrimidinylamino, substituted or unsubstituted indolyl, substituted or unsubstituted morpholino, substituted or unsubstituted alkylamido, substituted or unsubstituted arylamido, substituted or unsubstituted ureido, substituted or unsubstituted carbamoyl, and substituted or unsubstituted piperizinyl. In an exemplary embodiment, R9, R10, R11 and R12 are selected from the previous list of substituents with the exception of -C(O)R*, -C(O)OR*, - C(O)NR*R**.

[0132] In another exemplary embodiment, R9, R10, R11 and R12 are members independently selected from fluoro, chloro, bromo, nitro, cyano, amino, methyl, hydroxylmethyl, trifluoromethyl, methoxy, trifluoromethyoxy, ethyl, diethylcarbamoyl, pyridin-2-yl, pyridin-3-yl, pyridin-4-yl, pyrimidinyl, piperizino, piperizinyl, piperizinocarbonyl, piperizinylcarbonyl, carboxyl, 1-tetrazolyl, 1- ethoxycarbonylmethoxy, carboxymethoxy, thiophenyl, 3-(butylcarbonyl) phenylmethoxy, lH-tetrazol-5-yl, 1-ethoxycarbonylmethyloxy-, 1-ethoxycarbonylmethyl-, 1- ethoxycarbonyl-, carboxymethoxy-, thiophen-2-yl, thiophen-2-ylthio-, thiophen-3-yl, thiophen-3-ylthio, 4-fluorophenylthio, butylcarbonylphenylmethoxy, butylcarbonylphenylmethyl, butylcarbonylmethyl, l-(piperidin-l-yl)carbonyl)methyl, 1- (piperidin- 1 -yl)carbonyl)methoxy , 1 -(piperidin-2-yl)carbonyl)methoxy , 1 -(piperidin-3 - yl)carbonyl)methoxy, 1 -(4-(pyrimidin-2-yl)piperazin- 1 -yl)carbonyl)methoxy, 1 -(4- (pyrimidin-2-yl)piperazin- 1 -yl)carbonyl)methyl, 1 -(4-(pyrimidin-2-yl)piperazin- 1 - yl)carbonyl, 1 -4-(pyrimidin-2-yl)piperazin- 1 -yl, 1 -(4-(pyridin-2-yl)piperazin- 1 - yl)carbonyl), 1 -(4-(pyridin-2-yl)piperazin- 1 -yl)carbonylmethyl, ( 1 -(4-(pyridin-2- yl)piperazin- 1 -yl)carbonyl)-methoxy), 1 -(4-(pyridin-2-yl)piperazin- 1 -yl, 1 H-indol- 1 -yl, morpholino-, morpholinyl, morpholinocarbonyl, morpholinylcarbonyl, phenylureido, phenylcarbamoyl, acetamido, 3 -(phenylthio)-l H-indol- 1-yl, 3-(2-cyanoethylthio)-lH- indol-1-yl, benzylamino, 5 -methoxy-3-(phenylthio)-l H-indol- 1-yl, 5-methoxy-3-(2- cyanoethylthio)- 1 H-indol- 1 -yl)), 5 -chloro- 1 H-indol- 1 -yl, 5-chloro-3-(2-cyanoethylthio)- 1 H-indol- 1-yl)), dibenzylamino, benzylamino, 5 -chloro-3-(phenylthio)-l H-indol- 1-yl)), 4-(lH-tetrazol-5-yl)phenoxy, 4-(lH-tetrazol-5-yl)phenyl, 4-(lH-tetrazol-5-yl)phenylthio, 2-cyanophenoxy, 3-cyanophenoxy, 4-cyanophenoxy, 2-cyanophenylthio, 3- cyanophenylthio, 4-cyanophenylthio, 2-chlorophenoxy, 3-chlorophenoxy, A- chlorophenoxy, 2-fluorophenoxy, 3-fluorophenoxy, 4-fluorophenoxy, 2-cyanobenzyloxy, 3-cyanobenzyloxy, 4-cyanobenzyloxy, 2-chlorobenzyloxy, 3-chlorobenzyloxy, A- chlorobenzyloxy, 2-fluorobenzyloxy, 3-fluorobenzyloxy, 4-fluorobenzyloxy, unsubstituted phenyl, unsubstituted benzyl. In an exemplary embodiment, R9 is H and R12 is H.

[0133] In an exemplary embodiment, the ligand according to Formula (I) or Formula (II) is a member selected from:

[0134] In an exemplary embodiment, the ligand has a formula according to Formulae (Hb)-(IIe) wherein R1 is a member selected from H, a negative charge and a salt counterion and the remaining R group (R9 in lib, R10 in Hc, R11 in Hd, and R12 in He) is a member selected from fluoro, chloro, bromo, nitro, cyano, amino, methyl, hydroxylmethyl, trifluoromethyl, methoxy, trifluoromethyoxy, ethyl, diethylcarbamoyl, pyridin-2-yl, pyridin-3-yl, pyridin-4-yl, pyrimidinyl, piperizino, piperizinyl, piperizinocarbonyl, piperizinylcarbonyl, carboxyl, 1-tetrazolyl, 1- ethoxycarbonylmethoxy, carboxymethoxy, thiophenyl, 3-(butylcarbonyl) phenylmethoxy, lH-tetrazol-5-yl, 1-ethoxycarbonylmethyloxy-, 1-ethoxycarbonylmethyl-, 1- ethoxycarbonyl-, carboxymethoxy-, thiophen-2-yl, thiophen-2-ylthio-, thiophen-3-yl, thiophen-3-ylthio, 4-fluorophenylthio, butylcarbonylphenylmethoxy, butylcarbonylphenylmethyl, butylcarbonylmethyl, l-(piperidin-l-yl)carbonyl)methyl, 1- (piperidin- 1 -yl)carbonyl)methoxy , 1 -(piperidin-2-yl)carbonyl)methoxy , 1 -(piperidin-3 - yl)carbonyl)methoxy, 1 -(4-(pyrimidin-2-yl)piperazin- 1 -yl)carbonyl)methoxy, 1 -(4- (pyrimidin-2-yl)piperazin- 1 -yl)carbonyl)methyl, 1 -(4-(pyrimidin-2-yl)piperazin- 1 - yl)carbonyl, 1 -4-(pyrimidin-2-yl)piperazin- 1 -yl, 1 -(4-(pyridin-2-yl)piperazin- 1 - yl)carbonyl), 1 -(4-(pyridin-2-yl)piperazin- 1 -yl)carbonylmethyl, ( 1 -(4-(pyridin-2- yl)piperazin- 1 -yl)carbonyl)-methoxy), 1 -(4-(pyridin-2-yl)piperazin- 1 -yl, 1 H-indol- 1 -yl, morpholino-, morpholinyl, morpholinocarbonyl, morpholinylcarbonyl, phenylureido, phenylcarbamoyl, acetamido, 3 -(pheny ItMo)-I H-indol- 1-yl, 3-(2-cyanoethylthio)-lH- indol-1-yl, benzylamino, 5 -methoxy-3-(phenylthio)-l H-indol- 1-yl, 5-methoxy-3-(2- cyanoethylthio)- 1 H-indol- 1 -yl)), 5 -chloro- 1 H-indol- 1 -yl, 5-chloro-3-(2-cyanoethylthio)- 1 H-indol- 1-yl)), dibenzylamino, benzylamino, 5 -chloro-3-(phenylthio)-l H-indol- 1-yl)), 4-(lH-tetrazol-5-yl)phenoxy, 4-(lH-tetrazol-5-yl)phenyl, 4-(lH-tetrazol-5-yl)phenylthio, 2-cyanophenoxy, 3-cyanophenoxy, 4-cyanophenoxy, 2-cyanophenylthio, 3- cyanophenylthio, 4-cyanophenylthio, 2-chlorophenoxy, 3-chlorophenoxy, A- chlorophenoxy, 2-fluorophenoxy, 3-fluorophenoxy, 4-fluorophenoxy, 2-cyanobenzyloxy, 3-cyanobenzyloxy, 4-cyanobenzyloxy, 2-chlorobenzyloxy, 3-chlorobenzyloxy, A- chlorobenzyloxy, 2-fluorobenzyloxy, 3-fluorobenzyloxy and 4-fluorobenzyloxy.

[0135] In an exemplary embodiment, the ligand has a formula according to Formulae (Ilf)-(IIk) wherein R1 is a member selected from H, a negative charge and a salt counterion and each of the remaining two R groups (R9 and R10 in Hf, R9 and R11 in Hg, R9 and R12 in Hh, R10 and R11 in Hi, R10 and R12 in Hj, R11 and R12 in Ilk) is a member independently selected from fluoro, chloro, bromo, nitro, cyano, amino, methyl, hydroxylmethyl, trifluoromethyl, methoxy, trifluoromethyoxy, ethyl, diethylcarbamoyl, pyridin-2-yl, pyridin-3-yl, pyridin-4-yl, pyrimidinyl, piperizino, piperizinyl, piperizinocarbonyl, piperizinylcarbonyl, carboxyl, 1-tetrazolyl, 1- ethoxycarbonylmethoxy, carboxymethoxy, thiophenyl, 3-(butylcarbonyl) phenylmethoxy, lH-tetrazol-5-yl, 1-ethoxycarbonylmethyloxy-, 1-ethoxycarbonylmethyl-, 1- ethoxycarbonyl-, carboxymethoxy-, thiophen-2-yl, thiophen-2-ylthio-, thiophen-3-yl, thiophen-3-ylthio, 4-fluorophenylthio, butylcarbonylphenylmethoxy, butylcarbonylphenylmethyl, butylcarbonylmethyl, l-(piperidin-l-yl)carbonyl)methyl, 1- (piperidin- 1 -yl)carbonyl)methoxy , 1 -(piperidin-2-yl)carbonyl)methoxy , 1 -(piperidin-3 - yl)carbonyl)methoxy, 1 -(4-(pyrimidin-2-yl)piperazin- 1 -yl)carbonyl)methoxy, 1 -(4- (pyrimidin-2-yl)piperazin- 1 -yl)carbonyl)methyl, 1 -(4-(pyrimidin-2-yl)piperazin- 1 - yl)carbonyl, 1 -4-(pyrimidin-2-yl)piperazin- 1 -yl, 1 -(4-(pyridin-2-yl)piperazin- 1 - yl)carbonyl), 1 -(4-(pyridin-2-yl)piperazin- 1 -yl)carbonylmethyl, ( 1 -(4-(pyridin-2- yl)piperazin- 1 -yl)carbonyl)-methoxy), 1 -(4-(pyridin-2-yl)piperazin- 1 -yl, 1 H-indol- 1 -yl, morpholino-, morpholinyl, morpholinocarbonyl, morpholinylcarbonyl, phenylureido, phenylcarbamoyl, acetamido, 3 -(pheny ItMo)-I H-indol- 1-yl, 3-(2-cyanoethylthio)-lH- indol-1-yl, benzylamino, 5 -methoxy-3-(phenylthio)-l H-indol- 1-yl, 5-methoxy-3-(2- cyanoethylthio)- 1 H-indol- 1 -yl)), 5 -chloro- 1 H-indol- 1 -yl, 5-chloro-3-(2-cyanoethylthio)- 1 H-indol- 1-yl)), dibenzylamino, benzylamino, 5 -chloro-3-(phenylthio)-l H-indol- 1-yl)), 4-(lH-tetrazol-5-yl)phenoxy, 4-(lH-tetrazol-5-yl)phenyl, 4-(lH-tetrazol-5-yl)phenylthio, 2-cyanophenoxy, 3-cyanophenoxy, 4-cyanophenoxy, 2-cyanophenylthio, 3- cyanophenylthio, 4-cyanophenylthio, 2-chlorophenoxy, 3-chlorophenoxy, A- chlorophenoxy, 2-fluorophenoxy, 3-fluorophenoxy, 4-fluorophenoxy, 2-cyanobenzyloxy, 3-cyanobenzyloxy, 4-cyanobenzyloxy, 2-chlorobenzyloxy, 3-chlorobenzyloxy, A- chlorobenzyloxy, 2-fluorobenzyloxy, 3-fluorobenzyloxy, and 4-fluorobenzyloxy.

[0136] In an exemplary embodiment, the ligand has a formula according to Formulae (IH)-(IIo) wherein R1 is a member selected from H, a negative charge and a salt counterion and each of the remaining three R groups (R9, R10, R11 in (III), R9, R10, R12 in (Hm), R9, R11, R12 in (Hn), R10, R11, R12 in (Ho)) is a member independently selected from fluoro, chloro, bromo, nitro, cyano, amino, methyl, hydroxylmethyl, trifluoromethyl, methoxy, trifluoromethyoxy, ethyl, diethylcarbamoyl, pyridin-2-yl, pyridin-3-yl, pyridin- 4-yl, pyrimidinyl, piperizino, piperizinyl, piperizinocarbonyl, piperizinylcarbonyl, carboxyl, 1-tetrazolyl, 1-ethoxycarbonylmethoxy, carboxymethoxy, thiophenyl, 3- (butylcarbonyl) phenylmethoxy, lH-tetrazol-5-yl, 1-ethoxycarbonylmethyloxy-, 1- ethoxycarbonylmethyl-, 1-ethoxycarbonyl-, carboxymethoxy-, thiophen-2-yl, thiophen-2- ylthio-, thiophen-3-yl, thiophen-3-ylthio, 4-fluorophenylthio, butylcarbonylphenylmethoxy, butylcarbonylphenylmethyl, butylcarbonylmethyl, 1- (piperidin- 1 -yl)carbonyl)methyl, 1 -(piperidin- 1 -yl)carbonyl)methoxy, 1 -(piperidin-2- yl)carbonyl)methoxy, 1 -(piperidin-3-yl)carbonyl)methoxy, 1 -(4-(pyrimidin-2- yl)piperazin- 1 -yl)carbonyl)methoxy , 1 -(4-(pyrimidin-2-yl)piperazin- 1 - yl)carbonyl)methyl, 1 -(4-(pyrimidin-2-yl)piperazin- 1 -yl)carbonyl, 1 -4-(pyrimidin-2- yl)piperazin- 1 -yl, 1 -(4-(pyridin-2-yl)piperazin- 1 -yl)carbonyl), 1 -(4-(pyridin-2- yl)piperazin- 1 -yl)carbonylmethyl, ( 1 -(4-(pyridin-2-yl)piperazin- 1 -yl)carbonyl)-methoxy), l-(4-(pyridin-2-yl)piperazin-l-yl, lH-indol-1-yl, morpholino-, morpholinyl, morpholinocarbonyl, morpholinylcarbonyl, phenylureido, phenylcarbamoyl, acetamido, 3-(phenylthio)-lH-indol-l-yl, 3-(2-cyanoethylthio)-lH-indol-l-yl, benzylamino, 5- methoxy-3 -(phenylthio)- 1 H-indol- 1 -yl, 5 -methoxy-3 -(2-cyanoethylthio)- 1 H-indol- 1 -yl)), 5-chloro-lH-indol-l-yl, 5-chloro-3-(2-cyanoethylthio)-lH-indol-l-yl)), dibenzylamino, benzylamino, 5-chloro-3-(phenylthio)-lH-indol-l-yl)), 4-(lH-tetrazol-5-yl)phenoxy, A- (lH-tetrazol-5-yl)phenyl, 4-(lH-tetrazol-5-yl)phenylthio, 2-cyanophenoxy, 3- cyanophenoxy, 4-cyanophenoxy, 2-cyanophenylthio, 3-cyanophenylthio, A- cyanophenylthio, 2-chlorophenoxy, 3-chlorophenoxy, 4-chlorophenoxy, 2- fluorophenoxy, 3-fluorophenoxy, 4-fluorophenoxy, 2-cyanobenzyloxy, 3- cyanobenzyloxy, 4-cyanobenzyloxy, 2-chlorobenzyloxy, 3-chlorobenzyloxy, A- chlorobenzyloxy, 2-fluorobenzyloxy, 3-fluorobenzyloxy, and 4-fluorobenzyloxy.

[0137] In an exemplary embodiment, the ligand has a structure according to the following formula:

[0138] In an exemplary embodiment, the ligand has a structure according to the following formula:

. In an exemplary embodiment, R10 is halogen. In an exemplary embodiment, R10 is fluoro. In an exemplary embodiment, R10 is chloro. In an exemplary embodiment, R10 is substituted or unsubstituted cyanophenyloxy. In an exemplary embodiment, R10 is unsubstituted cyanophenyloxy. In an exemplary embodiment, R10 is p-cyanophenyloxy. [0139] In an exemplary embodiment, the ligand has a structure according to the following formula:

. In an exemplary embodiment, R12 is substituted or unsubstituted heteroalkyl. In an exemplary embodiment, the ligand has a structure according to the following formula:

, wherein p is a member selected from 1-15. In another exemplary embodiment, p is a member selected from 1-10. In another exemplary embodiment, p is a member selected from 1-5. In another exemplary embodiment, p is a member selected from 5-10. In another exemplary embodiment, p is 3.

[0140] In an exemplary embodiment, the ligand has a structure according to the following formula:

, wherein p is a member selected from 1-15. In another exemplary embodiment, p is a member selected from 1-10. In another exemplary embodiment, p is a member selected from 1-5. In another exemplary embodiment, p is a member selected from 5-10. In another exemplary embodiment, p is 1.

[0141] In an exemplary embodiment, the ligand has a structure according to the following formula:

. In an exemplary embodiment, R10 is halogen. In an exemplary embodiment, R10 is fluoro. In an exemplary embodiment, R10 is chloro.

[0142] In an exemplary embodiment, there is a proviso that the ligand does not have a structure according to the following formula:

[0143] In an exemplary embodiment, there is a proviso that the ligand does not have a structure according to the following formula:

. In an exemplary embodiment, the ligand is not 5-halo-l,3-dihydro-l- hydroxy-2,l-benzoxaborole. In an exemplary embodiment, the ligand is not 5-fluoro-l,3- dihydro-l-hydroxy-2,l-benzoxaborole. In an exemplary embodiment, the ligand is not 5- chloro-l,3-dihydro-l-hydroxy-2,l-benzoxaborole. In an exemplary embodiment, the ligand is not 5-substituted or unsubstituted cyanophenyloxy-l,3-dihydro-l-hydroxy-2,l- benzoxaborole. In an exemplary embodiment, the ligand is not 5 -unsubstituted cyanophenyloxy-l,3-dihydro-l-hydroxy-2,l-benzoxaborole. In an exemplary embodiment, the ligand is not 5- p-cyanophenyloxy-l,3-dihydro-l-hydroxy-2,l- benzoxaborole.

[0144] In an exemplary embodiment, there is a proviso that the ligand does not have a structure according to the following formula:

In an exemplary embodiment, the ligand is not R12 is not substituted or unsubstituted heteroalkyl. In an exemplary embodiment, there is a proviso that the ligand does not have a structure according to the following formula:

, wherein p is a member selected from 1-15. In another exemplary embodiment, p is a member selected from 1-10. In another exemplary embodiment, p is a member selected from 1-5. In another exemplary embodiment, p is a member selected from 5-10. In another exemplary embodiment, p is 3.

[0145] In an exemplary embodiment, there is a proviso that the ligand does not have a structure according to the following formula:

, wherein p is a member selected from 1-15. In another exemplary embodiment, p is a member selected from 1-10. In another exemplary embodiment, p is a member selected from 1-5. In another exemplary embodiment, p is a member selected from 5-10. In another exemplary embodiment, p is 1. In an exemplary embodiment, the ligand is not 3-aminomethyl-l,3-dihydro-l-hydroxy-2,l-benzoxaborole.

[0146] In an exemplary embodiment, there is a proviso that the ligand does not have a structure according to the following formula:

. In an exemplary embodiment, R10 is halogen. In an exemplary embodiment, the ligand is not 6-amino-5-fluoro-l,3-dihydro-l-hydroxy-2,l- benzoxaborole. In an exemplary embodiment, the ligand is not 6-amino-5-chloro-l,3- dihydro- 1 -hydroxy-2, 1 -benzoxaborole.

[0147] In another exemplary embodiment, there is a proviso that the ligand cannot have a structure according to Formula (Ix):

wherein R7b is a member selected from H, methyl, ethyl and phenyl. R10b is a member selected from H, OH, NH2, SH, halogen, substituted or unsubstituted phenoxy, substituted or unsubstituted phenylalkyloxy, substituted or unsubstituted phenylthio and substituted or unsubstituted phenylalkylthio. Rl lb is a member selected from H, OH, NH2, SH, methyl, substituted or unsubstituted phenoxy, substituted or unsubstituted phenylalkyloxy, substituted or unsubstituted phenylthio and substituted or unsubstituted phenylalkylthio. In another exemplary embodiment, there is a proviso that the ligand cannot have a structure according to Formula (Ix) wherein Rlb is a member selected from a negative charge, H and a salt counterion. In another exemplary embodiment, there is a proviso that the ligand cannot have a structure according to Formula (Ix) wherein R10b and Rl lb are H. In another exemplary embodiment, there is a proviso that the ligand cannot have a structure according to Formula (Ix) wherein one member selected from R10b and Rl lb is H and the other member selected from R10b and Rl lb is a member selected from halo, methyl, cyano, methoxy, hydroxymethyl and p-cyanophenyloxy. In another exemplary embodiment, there is a proviso that the ligand cannot have a structure according to Formula (Ix) wherein R10b and Rl lb are members independently selected from fluoro, chloro, methyl, cyano, methoxy, hydroxymethyl, and p-cyanophenyl. In another exemplary embodiment, there is a proviso that the ligand cannot have a structure according to Formula (Ix) wherein Rlb is a member selected from a negative charge, H and a salt counterion; R7b is H; R10b is F and Rl lb is H. In another exemplary embodiment, there is a proviso that the ligand cannot have a structure according to Formula (Ix) wherein Rllb and R12b, along with the atoms to which they are attached, are joined to form a phenyl group. In another exemplary embodiment, there is a proviso that the ligand cannot have a structure according to Formula (Ix) wherein Rlb is a member selected from a negative charge, H and a salt counterion; R7b is H; R10b is 4- cyanophenoxy; and Rl lb is H.

[0148] In another exemplary embodiment, there is a proviso that the ligand cannot have a structure according to Formula (Iy)

wherein R10b is a member selected from H, halogen, CN and substituted or unsubstituted Ci_4 alkyl.

[0149] In another exemplary embodiment, there is a proviso that a structure does not have a structure which is a member selected from Formulae (I) to (Io) at least one member selected from R3, R4, R5, R6, R7, R8, R9, R10, R11 and R12 is nitro, cyano or halogen. In another exemplary embodiment, there is a proviso that when M is oxygen, W is a member selected from (CR3R4)n, wherein n is 0, J is a member selected from (CR6aR7a)mi, wherein ml is 1, A is CR9a, D is CR1Oa, E is CRl la, G is CR12a, the R9a is not halogen, methyl, ethyl, or optionally joined with R1Oa to form a phenyl ring; R1Oa is not unsubstituted phenoxy, C(CH3 )3, halogen, CF3, methoxy, ethoxy, or optionally joined with R9a to form a phenyl ring; Rlla is not halogen or optionally joined with R1Oa to form a phenyl ring; and R12a is not halogen. In another exemplary embodiment, there is a proviso that when M is oxygen, W is a member selected from (CR3aR4a)ni, wherein nl is 0, J is a member selected from (CR6aR7a)mi, wherein ml is 1, A is CR9a, D is CR1Oa, E is CRlla, Gl is CR12a, then neither R6a nor R7a are halophenyl. In another exemplary embodiment, there is a proviso that when M is oxygen, W is a member selected from (CR3aR4a)ni, wherein nl is 0, J is a member selected from (CR6aR7a)mi, wherein ml is 1, A is CR9a, D is CR1Oa, E is CRl la, G is CR12a, and R9a, R1Oa and Rl la are H, then R6a, R7a and R12a are not H. In another exemplary embodiment, there is a proviso that when M is oxygen wherein nl is 1, J is a member selected from (CR6aR7a)mi, wherein ml is 0, A is CR9a, D is CR1Oa, E is CRl la, G is CR12a, R9a is H, R1Oa is H, Rl la is H, R6a is H, R7a is H, R12a is H, then W is not C=O (carbonyl). In another exemplary embodiment, there is a proviso that when M is oxygen, W is CR5a, J is CR8a, A is CR9a, D is CR1Oa, E is CRl la, G is CR12a, R6a, R7a, R9a, R1Oa, Rl la and R12a are H, then R5a and R8a, together with the atoms to which they are attached, do not form a phenyl ring.

[0150] In an exemplary embodiment, the ligand of the invention has a structure which is a member selected from:

in which q is a number between 0 and 1. Rg is halogen. Ra, Rb, Rc, Rd and Re are members independently selected from a member selected from H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. In an exemplary embodiment, there is a proviso that the ligand is not a member selected from

[0151] In an exemplary embodiment, the ligand has a structure is a member selected from:

(Iaj) and (Iak).

[0152] In an exemplary embodiment, R \ aa, τ R-> d and Re are each members indepenently selected from:

[0153] In an exemplary embodiment, Rb and Rc are members independently selected from H, methyl,

[0154] In another exemplary embodiment, Rb is H and Rc is a member selected from

H, methyl,

. In another exemplary embodiment, Rb and Rc are, together with the nitrogen to which they are attached, optionally joined to form a member selected from

[0155] In an exemplary embodiment, Ra is a member selected from

[0156] In an exemplary embodiment, Rd is a member selected from

[0157] In an exemplary embodiment, Re is a member selected from

[0158] In an exemplary embodiment, the ligand is a member selected from

[0159] In an exemplary embodiment, the ligand has a structure according to a member selected from Formulae II(b), II(c), II(d), and II(e) wherein said remaining R group (R9 for II(b), R10 for II(c), R11 for II(d) and R12 for II(e)) is carboxymethoxy.

[0160] In an exemplary embodiment, the ligand has a structure which is a member selected from Formulae (Hf) - (Ilk), wherein either R9 or R10 for Formula (Hf), either R9 or R11 for Formula (Hg), either R9 or R12 for Formula (Hh), either R10 or R11 for Formula (Hi), either R10 or R12 for Formula (Hj), either R11 or R12 for Formula (Ilk) is halogen, and the other substituent in the pairing (ex. if R9 is F in Formula (Hf), then R10 is selected from the following substituent listing), is a member selected from NH2, N(CHs)H, and N(CHs)2. [0161] In another exemplary embodiment, the ligand has a structure which is a member selected from:

in which R* and R** are members selected from: H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. In an exemplary embodiment, the ligand is a member selected from

, wherein R1 is a member selected from a negative charge, H and a salt counterion.

[0162] In another exemplary embodiment, the ligand has a structure which is a member selected from:

(Iak), wherein q is 1 and Rg is a member selected from fluoro, chloro and bromo. Pyridinyloxaboroles

[0163] In an exemplary embodiment, the ligand has a structure which is a member selected from Formulae (Ilia) (HIb) (IIIc) and (HId).

[0164] Compounds of use in the present invention can be prepared using commercially available starting materials, known intermediates, or by using the synthetic methods published in references described and incorporated by reference herein.

//. Methods of making the ligands

[0165] The following exemplary schemes illustrate methods of preparing boron- containing ligands of the present invention. These methods are not limited to producing the ligands shown. The ligands of the present invention can also be synthesized by methods not explicitly illustrated in the schemes but are well within the skill of one in the art. The ligands can be prepared using readily available materials of known intermediates.

[0166] In the following schemes, the symbol X represents bromo or iodo. The symbol Y is selected from H, lower alkyl, and arylalkyl. The symbol Z is selected from H, alkyl, and aryl. The symbol PG represents protecting group. The symbols A, D, E, G, Rx, Ry, Rz, R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, and R12 can be used to refer to the corresponding symbols in the compounds described herein.

Boronic Acid Preparation Strategy #1

[0167] In Scheme 1, Step 1 and 2, compounds 1 or 2 are converted into alcohol 3. In step 1 , compound 1 is treated with a reducing agent in an appropriate solvent. Suitable reducing agents include borane complexes, such as borane-tetrahydrofuran, borane- dimethylsulfide, combinations thereof and the like. Lithium aluminum hydride, or sodium borohydride can also be used as reducing agents. The reducing agents can be used in quantities ranging from 0.5 to 5 equivalents, relative to compound 1 or 2. Suitable solvents include diethyl ether, tetrahydrofuran, 1 ,4-dioxane, 1 ,2- dimethoxyethane, combinations thereof and the like. Reaction temperatures range from 00C to the boiling point of the solvent used; reaction completion times range from 1 to 24 h.

[0168] In Step 2, the carbonyl group of compound 2 is treated with a reducing agent in an appropriate solvent. Suitable reducing agents include borane complexes, such as borane-tetrahydrofuran, borane-dimethylsulfide, combinations thereof and the like. Lithium aluminum hydride, or sodium borohydride can also be used as reducing agents. The reducing agents can be used in quantities ranging from 0.5 to 5 equivalents, relative to compound 2. Suitable solvents include lower alcohol, such as methanol, ethanol, and propanol, diethyl ether, tetrahydrofuran, 1 ,4-dioxane and 1 ,2-dimethoxyethane, combinations thereof and the like. Reaction temperatures range from 00C to the boiling point of the solvent used; reaction completion times range from 1 to 24 h.

[0169] In Step 3, the hydroxyl group of compound 3 is protected with a protecting group which is stable under neutral or basic conditions. The protecting group is typically selected from methoxymethyl, ethoxyethyl, tetrahydropyran-2-yl, trimethylsilyl, tert- butyldimethylsilyl, tributylsilyl, combinations thereof and the like. In the case of methoxymethyl, compound 3 is treated with 1 to 3 equivalents of chloromethyl methyl ether in the presence of a base. Suitable bases include sodium hydride, potassium tert- butoxide, tertiary amines, such as diisopropylethylamine, triethylamine, 1,8- diazabicyclo[5,4,0]undec-7-ene, and inorganic bases, such as sodium hydroxide, sodium carbonate, potassium hydroxide, potassium carbonate, combinations thereof and the like. The bases can be used in quantities ranging from 1 to 3 equivalents, relative to compound 3. Reaction temperatures range from 00C to the boiling point of the solvent used; preferably between 0 and 40 0C; reaction completion times range from 1 h to 5 days.

[0170] In the case of tetrahydropyran-2-yl, compound 3 is treated with 1 to 3 equivalents of 3,4-dihydro-2H-pyran in the presence of 1 to 10 mol% of acid catalyst. Suitable acid catalysts include pyridinium/?-toluenesulfonic acid, /?-toluenesulfonic acid, camphorsulfonic acid, methanesulfonic acid, hydrogen chloride, sulfuric acid, combinations thereof and the like. Suitable solvents include dichloromethane, chloroform, tetrahydrofuran, 1 ,4-dioxane, 1 ,2-dimethoxyethane, toluene, benzene, and acetonitrile combinations thereof and the like. Reaction temperatures range from 00C to the boiling point of the solvent used; preferably between 0 and 60 0C, and is complete in Ih to 5 days.

[0171] In the case of trialkylsilyl, compound 3 is treated with 1 to 3 equivalents of chlorotrialkylsilyane in the presence of 1 to 3 equivalents of base. Suitable bases include tertiary amines, such as imidazole, diisopropylethylamine, triethylamine, 1,8- diazabicyclo[5,4,0]undec-7-ene, combinations thereof and the like. Reaction temperatures range from 00C to the boiling point of the solvent used; preferably between 0 and 40 0C; reaction completion times range from 1 to 48 h.

[0172] In Step 4, compound 4 is converted into boronic acid (5) through halogen metal exchange reaction. Compound 4 is treated with 1 to 3 equivalents of alkylmetal reagent relative to compound 4, such as n-butyllithium, sec-butyllithium, tert- butyllithium, isopropylmagnesium chloride or Mg turnings with or without an initiator such as diisobutylaluminum hydride (DiBAl), followed by the addition of 1 to 3 equivalents of trialkyl borate relative to compound 4, such as trimethyl borate, triisopropyl borate, or tributyl borate. Suitable solvents include tetrahydrofuran, ether, 1,4-dioxane, 1,2-dimethoxyethane, toluene, hexanes, combinations thereof and the like. Alkylmetal reagent may also be added in the presence of trialkyl borate. The addition of butyllithium is carried out at between -100 and 0 0C, preferably at between -80 and -40 0C. The addition of isopropylmagnesium chloride is carried out at between -80 and 40 0C, preferably at between -20 and 30 0C. The addition of Mg turnings, with or without the addition of DiBAl, is carried out at between -80 and 40 0C, preferably at between -35 and 30 0C. The addition of the trialkyl borate is carried out at between -100 and 20 0C. After the addition of trialkyl borate, the reaction is allowed to warm to room temperature, which is typically between -30 and 30 0C. When alkylmetal reagent is added in the presence of trialkyl borate, the reaction mixture is allowed to warm to room temperature after the addition. Reaction completion times range from 1 to 12 h. Compound 5 may not be isolated and may be used for the next step without purification or in one pot.

[0173] In Step 5, the protecting group of compound 5 is removed under acidic conditions to give compound of the invention. Suitable acids include acetic acid, trifluoroacetic acid, hydrochloric acid, hydrobromic acid, sulfuric acid, /?-toluenesulfonic acid and the like. The acids can be used in quantities ranging from 0.1 to 20 equivalents, relative to compound 5. When the protecting group is trialkylsilyl, basic reagents, such as tetrabutylammonium fluoride, can also be used. Suitable solvents include tetrahydrofuran, 1,4-dioxane, 1 ,2-dimethoxyethane, methanol, ethanol, propanol, acetonitrile, acetone, combination thereof and the like. Reaction temperatures range from 00C to the boiling point of the solvent used; preferably between 10 0C and reflux temperature of the solvent; reaction completion times range from 0.5 to 48 h. The product can be purified by methods known to those of skill in the art.

4

I or II, R'=H, W=(CR6R7)m, m=0

[0174] In another aspect, the invention provides a method of making a tetrahydropyran-containing boronic ester, said ester having a structure according to the following formula:

wherein R1 and R2 are members independently selected from H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. R1 and R2, together with the atoms to which they are attached, can be optionally joined to form a 4- to 7- membered ring. R9, R10, R11 and R12 are members independently selected from H, OR*, NR*R**, SR*, - S(O)R*, -S(O)2R*, -S(O)2NR*R**, nitro, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. R* and R** is a member selected from H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. The method comprises: a) subjecting a first compound to Grignard or organolithium conditions, said first compound having a structure according to the following formula:

b) contacting the product of step a) with a borate ester, thereby forming said tetrahydropyran-containing boronic ester. In an exemplary embodiment, halogen is a member selected from iodo and bromo. In another exemplary embodiment, the borate ester is a member selected from B(OR1)2(OR2), wherein R1 and R2 are each members independently selected from H, substituted or unsubstituted methyl, substituted or unsubstituted ethyl, substituted or unsubstituted propyl, substituted or unsubstituted isopropyl, substituted or unsubstituted butyl, substituted or unsubstituted t-butyl, substituted or unsubstituted phenyl and substituted or unsubstituted benzyl. R1 and R2, together with the atoms to which they are joined, can optionally form a member selected from substituted or unsubstituted dioxaborolane, substituted or unsubstituted dioxaborinane and substituted or unsubstituted dioxaborepane. In another exemplary embodiment, the borate ester is a member selected from B(OR^2(OR2), wherein R1 and R2, together with the atoms to which they are joined, form a member selected from dioxaborolane, substituted or unsubstituted tetramethyldioxaborolane, substituted or unsubstituted phenyldioxaborolane, dioxaborinane, dimethyldioxaborinane and dioxaborepane. In another exemplary embodiment, the Grignard or organolithium conditions further comprise diisobutyl aluminum hydride. In another exemplary embodiment, the temperature of the Grignard reaction does not exceed about 35C. In another exemplary embodiment, the temperature of the Grignard reaction does not exceed about 400C. In another exemplary embodiment, the temperature of the Grignard reaction does not exceed about 45C. In an exemplary embodiment, step (b) is performed at a temperature of from about -300C to about -200C. In another exemplary embodiment, step (b) is performed at a temperature of from about -35C to about -25C. In another exemplary embodiment, step (b) is performed at a temperature of from about -500C to about -00C. In another exemplary embodiment, step (b) is performed at a temperature of from about -400C to about -200C. In another exemplary embodiment, the tetrahydropyran-containing boronic ester is

[0175] In another aspect, the invention provides a method of making a compound having a structure according to the following formula

said method comprising: a) subjecting a first compound to Grignard or organo lithium conditions, said first compound having a structure according to the following formula:

b) quenching said subjecting reaction with water and a organic acid, thereby forming said compound. In an exemplary embodiment, wherein said organic acid is a member selected from acetic acid. In another exemplary embodiment, the quenching step is essentially not contacted with a strong acid. In another exemplary embodiment, the compound is 1,3- dihydro-5-fluoro-l-hydroxy-2,l-benzoxaborole. In another exemplary embodiment, the compound is purified by recrystallization from a recrystallization solvent, wherein said recrystallization solvent essentially does not contain acetonitrile. In an exemplary embodiment, the recrystallization solvent contains less than 2% acetonitrile. In an exemplary embodiment, the recrystallization solvent contains less than 1% acetonitrile. In an exemplary embodiment, the recrystallization solvent contains less than 0.5% acetonitrile. In an exemplary embodiment, the recrystallization solvent contains less than 0.1% acetonitrile. In an exemplary embodiment, the recrystallization solvent contains toluene and a hydrocarbon solvent. In an exemplary embodiment, the recrystallization solvent contains about 1 :1 toluene: hydrocarbon solvent. In an exemplary embodiment, the recrystallization solvent contains about 2:1 toluene: hydrocarbon solvent. In an exemplary embodiment, the recrystallization solvent contains about 3:1 toluene: hydrocarbon solvent. In an exemplary embodiment, the recrystallization solvent contains about 4:1 toluene: hydrocarbon solvent. In an exemplary embodiment, the hydrocarbon solvent is a member selected from heptane, octane, hexane, pentane and nonane. In an exemplary embodiment, the recrystallization solvent is 3:1 toluene: heptane. Boronic Acid Preparation Strategy #2

[0176] In Scheme 2, Step 6, compound 2 is converted into boronic acid (6) via a transition metal catalyzed cross-coupling reaction. Compound 2 is treated with 1 to 3 equivalents of bis(pinacolato)diboron or 4,4,5,5-tetramethyl-l,3,2-dioxaborolane in the presence of transition metal catalyst, with the use of appropriate ligand and base as necessary. Suitable transition metal catalysts include palladium(II) acetate, palladium(II) acetoacetonate, tetrakis(triphenylphosphine)palladium, dichlorobis(triphenylphosphine)palladium, [1,1 ' -bis(diphenylphosphino)ferrocen] dichloropalladium(II), combinations thereof and the like. The catalyst can be used in quantities ranging from 1 to 5 mol% relative to compound 2. Suitable ligands include triphenylphosphine, tri(o-tolyl)phosphine, tricyclohexylphosphine, combinations thereof and the like. The ligand can be used in quantities ranging from 1 to 5 equivalents relative to compound 2. Suitable bases include sodium carbonate, potassium carbonate, potassium phenoxide, triethylamine, combinations thereof and the like. The base can be used in quantities ranging from 1 to 5 equivalents relative to compound 2. Suitable solvents include Λ/,Λ/-dimethylformamide, dimethylsufoxide, tetrahydrofuran, 1,4- dioxane, toluene, combinations thereof and the like. Reaction temperatures range from 20 0C to the boiling point of the solvent used; preferably between 50 and 150 0C; reaction completion times range from 1 to 72 h.

[0177] Pinacol ester is then oxidatively cleaved to give compound 6. Pinacol ester is treated with sodium periodate followed by acid. Sodium periodate can be used in quantities ranging from 2 to 5 equivalents relative to compound 6. Suitable solvents include tetrahydrofuran, 1 ,4-dioxane, acetonitrile, methanol, ethanol, combinations thereof and the like. Suitable acids include hydrochloric acid, hydrobromic acid, sulfuric acid combinations thereof and the like. Reaction temperatures range from 0 0C to the boiling point of the solvent used; preferably between 0 and 50 0C; reaction completion times range from 1 to 72 h.

[0178] In Step 7, the carbonyl group of compound 6 is treated with a reducing agent in an appropriate solvent to give a compound of the invention. Suitable reducing agents include borane complexes, such as borane -tetrahydrofuran, borane-dimethylsulfide, combinations thereof and the like. Lithium aluminum hydride, or sodium borohydride can also be used as reducing agents. The reducing agents can be used in quantities ranging from 0.5 to 5 equivalents, relative to compound 6. Suitable solvents include lower alcohol, such as methanol, ethanol, and propanol, diethyl ether, tetrahydrofuran, 1,4-dioxane and 1,2-dimethoxyethane, combinations thereof and the like. Reaction temperatures range from 00C to the boiling point of the solvent used; reaction completion times range from 1 to 24 h.

Scheme 2

6

OR1

Step 7 E .G B.

"*" I l

D ,W

I or II, R'=H, W=(CR6: R7)m, m=0

Boronic Acid Preparation Strategy #3

[0179] In Scheme 3, Step 8, compounds of the invention can be prepared in one step from compound 3. Compound 3 is mixed with trialkyl borate then treated with alkylmetal reagent. Suitable alkylmetal reagents include n-butyllithium, sec-butyllithium, tert-butyllithium combinations thereof and the like. Suitable trialkyl borates include trimethyl borate, triisopropyl borate, tributyl borate, combinations thereof and the like. The addition of butyllithium is carried out at between -100 and 0 0C, preferably at between -80 and -40 0C. The reaction mixture is allowed to warm to room temperature after the addition. Reaction completion times range from 1 to 12 h. The trialkyl borate can be used in quantities ranging from 1 to 5 equivalents relative to compound 3. The alkylmetal reagent can be used in quantities ranging from 1 to 2 equivalents relative to compound 3. Suitable solvents include tetrahydrofuran, ether, 1,4-dioxane, 1,2- dimethoxyethane, toluene, hexanes, combinations thereof and the like. Reaction completion times range from 1 to 12 h. Alternatively, a mixture of compound 3 and trialkyl borate can be refluxed for 1 to 3 h and the alcohol molecule formed upon the ester exchange can be distilled out before the addition of alkylmetal reagent.

Scheme 3

Boronic Acid Preparation Strategy #4

[0180] In Scheme 4, Step 10, the methyl group of compound 7 is brominated using N- bromosuccinimide. N-bromosuccinimide can be used in quantities ranging from 0.9 to 1.2 equivalents relative to compound 7. Suitable solvents include carbon tetrachloride, tetrahydrofuran, 1,4-dioxane, chlorobenzene, combinations thereof and the like. Reaction temperatures range from 20 0C to the boiling point of the solvent used; preferably between 50 and 150 0C; reaction completion times range from 1 to 12 h.

[0181] In Step 11, the bromomethylene group of compound 8 is converted to the benzyl alcohol 3. Compound 8 is treated with sodium acetate or potassium acetate. These acetates can be used in quantities ranging from 1 to 10 equivalents relative to compound 8. Suitable solvents include tetrahydrofuran, 1,4-dioxane, NN- dimethylformamide, NN-dimethylacetamide, N-methylpyrrolidone, dimethylsulfoxide, combinations thereof and the like. Reaction temperatures range from 20 0C to the boiling point of the solvent used; preferably between 50 and 100 0C; reaction completion times range from 1 to 12 h. The resulting acetate is hydro lyzed to compound 3 under basic conditions. Suitable bases include sodium hydroxide, lithium hydroxide, potassium hydroxide, combinations thereof and the like. The base can be used in quantities ranging from 1 to 5 equivalents relative to compound 8. Suitable solvents include methanol, ethanol, tetrahydrofuran, water, combinations thereof and the like. Reaction temperatures range from 20 0C to the boiling point of the solvent used; preferably between 50 and 100 0C; reaction completion times range from 1 to 12 h. Alternatively, compound 8 can be directly converted into compound 3 under the similar condition above.

[0182] Steps 3 through 5 convert compound 3 into a compound of the invention.

Scheme 4

7 8

Step 11 βsV X

.OH

3

OR1

Steps 3 though 5

E

— - Il

D

I or ll, R'=H, W=(CR 6R7)m, m=0 Boronic Acid Preparation Strategy #5

[0183] In Scheme 5, Step 12, compound 2 is treated with (methoxymethyl) triphenylphosphonium chloride or (methoxymethyl)triphenylphosphonium bromide in the presence of base followed by acid hydrolysis to give compound 9. Suitable bases include sodium hydride, potassium tert-butoxide, lithium diisopropylamide, butyllithium, lithium hexamethyldisilazane, combinations thereof and the like. The

(methoxymethyl)triphenylphosphonium salt can be used in quantities ranging from 1 to 5 equivalents relative to compound 2. The base can be used in quantities ranging from 1 to 5 equivalents relative to compound 2. Suitable solvents include tetrahydrofuran, 1,2- dimethoxyethane, 1,4-dioxane, ether, toluene, hexane, Λ/,N-dimethylformamide, combinations thereof and the like. Reaction temperatures range from 0 0C to the boiling point of the solvent used; preferably between 0 and 30 0C; reaction completion times range from 1 to 12 h. The enolether formed is hydro lyzed under acidic conditions. Suitable acids include hydrochloric acid, hydrobromic acid, sulfuric acid, and the like. Suitable solvents include tetrahydrofuran, 1 ,2-dimethoxyethane, 1 ,4-dioxane, methanol, ethanol, combination thereof and the like. Reaction temperatures range from 20 0C to the boiling point of the solvent used; preferably between 50 and 100 0C; reaction completion times range from 1 to 12 h.

[0184] Steps 2 through 5 convert compound 9 into a compound of the invention.

Scheme 5

I or II, R'=H

Boronic Acid Preparation Strategy #6

[0185] In Scheme 6, compound (I) wherein R1 is H is converted into compound (I) wherein R1 is alkyl by mixing with the corresponding alcohol, R1OH. The suitable solvents include tetrahydrofuran, 1 ,2-dimethoxyethane, 1,4-dioxane, toluene, combinations thereof and the like. The alcohol (R1OH) can be used as the solvent as well. Reaction temperatures range from 20 0C to the boiling point of the solvent used; preferably between 50 and 100 0C; reaction completion times range from 1 to 12 h.

Scheme 6

I OT II1 R1 = H I or II, Rl ≠ H

[0186] The compounds of the invention can be converted into hydrates and solvates by methods similar to those described above.

/. c.) Adenosine-containing moiety

[0187] The term, "adenosine-containing moiety", as used herein, refers to a compound which contains an adenosine moiety at at least one terminus. In an exemplary embodiment, the adenosine-containing moiety has a structure according to the following formula:

L is substituted or unsubstituted adenine. A is a member selected from OH, substituted or unsubstituted monophosphate, substituted or unsubstituted diphosphate, substituted or

O A1 O P O. unsubstituted triphosphate, O I- V ; and

Al is a nucleic acid sequence which comprises between 1 and 200 nucleotides. In an exemplary embodiment, the adenosine-containing moiety is a member selected from adenosine monophosphate, adenosine diphosphate and adenosine triphosphate.

[0188] In another exemplary embodiment, Al is a nucleic acid sequence between 72 and 90 nucleotides. In another exemplary embodiment, Al is a nucleic acid sequence between 35 and 150 nucleotides. In another exemplary embodiment, Al is a nucleic acid sequence between 50 and 100 nucleotides. In another exemplary embodiment, Al is a nucleic acid sequence between 75 and 85 nucleotides. In another exemplary embodiment, Al is a nucleic acid sequence which is a leucyl tRNA or a portion of a leucyl tRNA. In another exemplary embodiment, Al is a nucleic acid sequence wherein two final nucleotides are each cytidine.

///. The Methods

[0189] Determination of the mechanism of inhibition of the editing domain of bacterial leucyl tRNA synthetase provides important information for rational design of bacterial leucyl tRNA synthetase ligands, e.g. via computational techniques which identify possible binding ligands for the editing domain. These techniques are discussed in more detail below.

[0190] Greer et al. (J. of Medicinal Chemistry, 37, (1994), 1035-1054) described an iterative approach to ligand design based on repeated sequences of computer modeling, protein-ligand complex formation and X-ray crystallographic or NMR spectroscopic analysis. More specifically, using e.g. GRID (Goodford, J of Medicinal Chemistry, 28, (1985), 849-857.) on the solved 3D structure of bacterial leucyl tRNA synthetase, a ligand (e.g. a candidate inhibitor) for the editing domain of a bacterial leucyl tRNA synthetase may be designed that complements the functionalities of the editing domain binding site. The ligand can then be synthesised, formed into a complex with bacterial leucyl tRNA synthetase, and the complex is then analyzed by X-ray crystallography to identify the actual position of the bound ligand. The structure and/or functional groups of the ligand can then be adjusted, if necessary, in view of the results of the X-ray analysis, and the synthesis and analysis sequence repeated until an optimised ligand is obtained. Related approaches to structure-based drug design are also discussed in Bohacek et al., Medicinal Research Reviews, 16, (1996), 3-50.

[0191] As a result of the determination of the mechanism of inhibition of the editing domain, more purely computational techniques for rational drug design may also be used to design bacterial leucyl tRNA synthetase editing domain ligands/inhibitors (for an overview of these techniques see e.g. Walters et al. mentioned above). For example, automated ligand-receptor docking programs (discussed e.g. by Jones et al. in Current Opinion in Biotechnology, 6, (1995), 652-656) which require accurate information on the atomic coordinates of target receptors may be used to design candidate bacterial leucine tRNA synthetase ligands/inhibitors.

[0192] The approaches to structure-based drug design described above all require initial identification of possible ligands for interaction with the target biomolecule (in this case leucine tRNA synthetase). Sometimes these compounds are known e.g. from the research literature. However, when they are not, or when novel ligands are wanted, a first stage of the drug design program may involve computer-based in silico screening of compound databases (such as the Cambridge Structural Database) with the aim of identifying compounds which interact with the editing domain or sites of the target biomolecule. Screening selection criteria may be based on pharmacokinetic properties such as metabolic stability and toxicity. However, determination of the mechanism of inhibition of the editing domain of bacterial leucyl tRNA synthetase allows the architecture and chemical nature of the editing domain binding site to be better defined, which in turn allows the geometric and functional constraints of a descriptor for the candidate inhibitor to be derived more accurately. The descriptor is, therefore, a type of virtual 3-D pharmacophore, which can also be used as selection criteria or filter for database screening.

[0193] Please see FIG. 2 and/or FIG. 4 for more information on the x-ray structure quality statistics.

[0194] While the invention has been described in conjunction with the exemplary embodiments described above, many equivalent modifications and variations will be apparent to those skilled in the art when given this disclosure. Accordingly, the exemplary embodiments of the invention set forth are considered to be illustrative and not limiting. Various changes to the described embodiments may be made without departing from the spirit and scope of the invention.

EXAMPLES

[0195] General: Melting points were obtained using a Mel-Temp-II melting point apparatus and are uncorrected. 1H NMR spectra were recorded on Oxford 300 (300 MHz) spectrometer (Varian). Mass spectra were determined on API 3000 (Applied Biosystems). Purity by HPLC (relative area) was determined using ProStar Model 330 (PDA detector, Varian), Model 210 (pump, Varian), and a BetaBasic-18 4.6 x 150 mm column (Thermo Electron Corporation) with a linear gradient of 0 to 100% MeCN in 0.01% H3PO4 over 10 min followed by 100% MeCN for another lOmin at 220 nm.

EXAMPLE 1

Protein purification

[0196] Leucyl tRNA synthetases of Thermus Thermophilus (LeuRSTT) and were cloned, sequenced and overexpressed in Escherichia coli strain BL21(DE3)pLysS as described by Tukalo et al. (2000). The cells carrying the recombinant plasmid were grown at 310 K in 4 L Luria-Bertani medium containing 50 μg ml"1 kanamycin and 34 μg ml"1 chloramphenicol until the ODβoo reached 0.6-0.8. Overexpression was induced by addition of 1 mMIPTG; after 4 h of induction at 310 K, the cells were harvested by centrifugation (15 min, 600Og at 277 K). The cell pellet was resuspended in ice-cold lysis buffer containing 100 mMTris-HCl pH 8.0, 5 mMEDTA, 30 mM 2-mercaptoethanol, 5 mMphenylmethylsulfonyl fluoride (PMSF), Complete (a protease-inhibitor cocktail, one tablet per 25 mL extraction buffer), 4% glycerol and 20 vaM lysozyme and homogenized by sonication. After 30 min incubation at room temperature with DNAase (25 mg ml"1) and 1 mM MgCl2, the crude lysate was clarified by centifugation for 30 min at 10,000g and incubated at 343 K for 40 min. Most of the host E. coli proteins were denatured and precipitated by heating and were removed by centrifugation for 30 min at 20,00Og. The supernatant was dialysed against 20 mMTris-HCl buffer pH 7.9 containing 5 mM MgCl2, 0.1 mMPMSF, 2 mMDTT, 1 mMNaN3 (buffer A) and absorbed on a DEAE-Sepharose column (2.5 x 55 cm) equilibrated with buffer A. The leucyl-tRNA synthetase was eluted with a 2 x 0.8 L linear gradient of 0.03-0.3 M sodium chloride in buffer A. The fractions containing LeuRS activity were pooled, dialyzed in buffer A and chromatographed on a heparin Sepharose CL-6B column (1 x 40 cm). A 1.0 L linear 0-0.25 MKCl gradient in buffer A was used to elute the LeuRS. All enzyme-purification steps were carried out at 277 K. The final yield was about 20 mg of pure LeuRS from 1 L of cells.

[0197] tRNALeu transcript. We prepared a plasmid containing the T. thermophilus tRNALeu (CAG) gene with a 2-base-pair deletion in the long variable arm by the hybridization often overlapping phosphorylated oligonucleotides, ligation between BamHI and HindIII sites of plasmid pUC19 and transformation into DH5α cells. The gene contained the T7 RNA polymerase promoter region followed by the tRNA sequence. Transcripts of the tRNA gene were prepared in a reaction mixture containing 0.1 M Tris-HCl (pH 8.0), 5 mM dithiothreitol, 1 niM spermidine, 15 niM MgCl2, 4 mM of each nucleoside 5 '-triphosphate, 20 mM guanosine 5 '-monophosphate, BstNI-digested template DNA (0.15 mg mL"1) and pure T7 RNA polymerase for 3 h at 37C. The transcripts were purified by denaturing 10% polyacrylamide gel electrophoresis, eluted and ethanol-precipitated. After ethanol precipitation the pellet was resuspended in 5 mM HEPES (pH 7.0) and heated to 68C for 3 min, at which time MgCl2 was added to 15 mM and the solution allowed to slow cool at room temperature for 50-60 min.

[0198] Mutagenesis. Using the T. thermophilics leuS gene as template, we PCR- amplified the DNA fragment encoding LeuRSTT lacking the last 60 residues, with the appropriate (Ndel and Hindlll) restriction sites on both ends. The gene encoding truncated LeuRSTT (LeuRSTTdC) was cloned into the plasmid pET29b, overexpressed in E. coli strain BL21(DE3)pLys and purified as described for full-length LeuRSTT.

[0199] Aminoacylation assay. We carried out aminoacylation assays at 37C in a reaction mixture containing 50 mM HEPES (pH 7.5), 15 mM MgCl2, 2.5 mM ATP, 1 mM DTT, 0.1 mg ml"1 BSA, 25 μM L- [U- 14C] leucine (325 mCi mmol"1), 7.5 μM tRNALeu transcript and 3-10 nM LeuRSTT. At appropriate time points, 10 μL samples were spotted on Whatman 3MM paper that had previously been soaked in 10% trichloroacetic acid. Spotted papers were washed twice in 5% trichloroacetic acid and once in 95% ethanol. The washed papers were dried and the radioactivity was measured by liquid scintillation counting.

EXAMPLE 2

Protein Crystallisation

[0200] Crystallization and data collection. Crystals of LeuRSTT in complex with adenosine monophosphate (AMP) and Cl were grown at 20 0C by hanging drop vapor diffusion. Crystals were obtained after equilibration of 5 μL of protein- AMP- Cl solution (5 mg ml"1 of LeuRSTT, protein/ AMP-Cl molar ratio of 1.0:1.2, 5 mM leucine, 15 mM MgCl2, 50 mM MES (pH 6.5) and 0.8 M ammonium sulfate) against 0.8 mL of reservoir solution containing 1.5 M ammonium sulfate and 0.1 M MES (pH 6.5).

[0201] Crystals of LeuRSTT in complex with the tRNALeu transcript and Cl were grown at 20 0C by hanging drop vapor diffusion. Crystals were obtained after equilibration of 5 μL of protein- tRNALeu and Cl solution (5 mg ml"1 of LeuRSTT, protein/ AMP- Cl molar ratio of 1.0:1.2, 5 mM leucine, 15 mM MgCl2, 50 mM MES (pH 6.5) and 0.8 M ammonium sulfate) against 0.8 mL of reservoir solution containing 1.5 M ammonium sulfate and 0.1 M MES (pH 6.5).

[0202] Crystals were cryoprotected with 25% glycerol before flash freezing. Diffraction data were collected on ESRF undulator beamline ID14-EH4 (native complex) and EH2 (soaked with Nva2aa) with X-ray wavelengths of, respectively, 0.980 and 0.933 A. Data were integrated with XDS (Kabsch, J. Appl. Crystallogr. 26, 795-800 (1993)).

EXAMPLE 3

Structure determination and refinement

[0203] We solved the structure by molecular replacement (MOLREP)(^cto Crystallogr. D Biol. Crystallogr. 50, 760-763 (1994)) using the 2-A resolution structure of LeuRSTT (PDB entry 1H3N). Two complexes were found in the asymmetric unit related by a pseudo two-fold axis. Maps considerably improved after the correct orientation of the editing domain (rotated by 35) was found by visual inspection of difference maps. After successive rounds of model building using O (Jones et al. Acta Crystallogr A 47, 110-119 (1991)) and refinement, almost complete models for the tRNA and the C-terminal domain of the synthetase could be built. CNS refinement was performed using standard protocols, including maximum-likelihood target, solvent correction and anisotropic temperature factor (Brunger, A.T. et al. Acta Crystallogr. D Biol. Crystallogr. 54, 905-921 (1998)), with the addition of base planarity, sugar pucker (B-form for nucleotides 7, 9, 18-20, 48, 58 and 60) and Watson-Crick restraints on the tRNA base pairs, owing to the relatively low resolution. For the native data (3.3-A resolution), the geometries of the two complexes in the asymmetric unit were restrained by tight noncrystallographic symmetry while their B-factors were allowed to diverge. The 5-factors for the second complex (protein chain D, tRNA chain E) were higher, on average, than those for the first complex (protein chain A, tRNA chain B): the former were on average 25 A and 12 A higher for the protein and the tRNA, respectively. For the complex with Nva2AA (2.9- to 3 -A resolution), noncrystallographic symmetry restraints were relaxed, as guided by the behavior of Rfree. Poorly ordered regions in each structure included protein residues 293-303, 848-862 and 877-878 and tRNA anticodon loop nucleotides 31-39. The Ramachandran plot shows, for the favorable, additional, generous and disallowed regions, respectively, 76.4, 22.7, 0.7 and 0.1% for the native structure and 81.8, 17.8, 0.3 and 0.1% for the Nva2aa-bound structure. In both cases, poorly ordered Val861 is in the disallowed region.

EXAMPLE 4

Synthesis ofLigands

[0204] Ligands of use in the invention can be purchased commercially. For example, l,3-dihydro-l-hydroxy-2,l-benzoxaborole (C2) was purchased from Lancaster Synthesis. Ligands can also be synthesized from descriptions provided in publications such as in PCT Pat. Pub. WO06089067A2 (published Aug. 24, 2006) or U.S. Pat. App. No. 11/505,591.

5-Fluoro-l,3-dihvdro-l-hvdroxy-2, 1-benzoxaborole (Cl)

[0205] 1-Hydroxy-dihydrobenzoxaboroles, such as Cl, were synthesized as shown in Scheme 1. The protected o-bromobenzyl alcohol derivative (18), prepared from 16 or 17, was converted into the corresponding phenyl boronic acid. Deprotection of the methoxymethyl ether using hydrochloric acid followed by spontaneous cyclization gave the target compounds.

Scheme 7

Conditions (a) NaBH4, MeOH, rt (when X = H ), or BH3-THF, THF, rt (when X = OH), (b) MeOCH2CI, /-Pr2NEt, CH2CI2, rt, (c) MeMgBr, THF, -78 0C to rt , (d) NBS, AIBN, CCI4, reflux, (e) NaOAc, DM F, 70 0C, (f) NaOH, MeOH, reflux, (g) n-BuLι, (/-PrO)3B, THF, -780C to rt, (h) 6N HCI, THF, rt

1 ,3-Dihvdr o-l -hydroxy- 2, l-naphtho[2, 1-dloxaborole (C3)

[0206] To a solution of 1-bromonaphthaldehyde (62.0 g, 293 mmol) in MeOH (400 mL) was added NaBH4 (5.57 g, 147 mmol) portionwise at 00C, and the mixture was stirred at room temperature for 1 h. Water was added, and the solvent was removed under reduced pressure to about a half volume. The mixture was poured into EtOAc and water. The organic layer was washed with brine and dried over anhydrous Na2SO4. The solvent was removed under reduced pressure and used for the next step without purification. The compound (60.8 g, 293 mmol) and /-Pr2NEt (61 mL, 0.35 mol) in CH2Cl2 was added chloromethyl methyl ether (27 mL, 0.35 mmol) at 00C, and the mixture was stirred at room temperature overnight. Water was added, and the mixture was extracted with CHCI3. The organic layer was washed with brine and dried over anhydrous Na2SO4. The solvent was removed under reduced pressure to afford l-bromo-2- (methoxymethoxymethyl)naphthalene. To a solution of l-bromo-2- (methoxymethoxymethyl)naphthalene (73.2 g, 293 mmol) in dry THF (400 mL) was added n-butyllithium (1.6 M in hexanes; 200 mL) over 45 min at - 78C under nitrogen atmosphere. Anion precipitated. After 5 min, (/-PrO)3B (76.0 mL, 330 mmol) was added over 10 min, and the mixture was allowed to warm to room temperature over 1.5 h. Water and 6 N HCl (55 mL) were added, and the solvent was removed under reduced pressure to about a half volume. The mixture was poured into ethyl acetate and water. The organic layer was washed with brine and dried over anhydrous Na2SO4. The solvent was removed under reduced pressure. To a solution of the residue in tetrahydrofuran (360 mL) was added 6 N HCl (90 mL), and the mixture was stirred at 300C overnight. The solvent was removed under reduced pressure to about a half volume. The mixture was poured into ethyl acetate and water. The organic layer was washed with brine and dried over anhydrous Na2SO4. The solvent was removed under reduced pressure, and the residue was treated with /-Pr2O/hexane to give l,3-dihydro-l-hydroxy-2,l-naphtho[2,l- d]oxaborole (26.9 g, 60%) as a white powder: mp 139-143C; 1H NMR (300 MHz, DMSO-J6) δ (ppm) 5.09 (s, 2H), 7.59-7.47 (m, 3H), 7.95 (d, J= 7.5 Hz, IH), 7.99 (d, J = 8.1 Hz, IH), 8.28 (dd, J= 6.9, 0.6 Hz, IH), 9.21 (s, IH); ESI-MS m/z 185 (M+H)+; Anal

EXAMPLE 5

Synthesis of additional ligands Preparation of 3 from 1

Reduction of Carboxylic Acid

[0207] To a solution of 1 (see Scheme 1) (23.3 mmol) in anhydrous THF (70 mL) under nitrogen was added dropwise a BH3 THF solution (1.0 M, 55 mL, 55 mmol) at 00C and the reaction mixture was stirred overnight at room temperature. Then the mixture was cooled again with ice bath and MeOH (20 niL) was added dropwise to decompose excess BH3. The resulting mixture was stirred until no bubble was released and then 10% NaOH (10 mL) was added. The mixture was concentrated and the residue was mixed with water (200 mL) and extracted with EtOAc. The residue from rotary evaporation was purified by flash column chromatography over silica gel to give 20.7 mmol of 3 (see Scheme 1).

Preparation of 3 from 2

Reduction of Aldehyde

[0208] To a solution of 2 (see Scheme 1) (Z = H, 10.7 mmol) in methanol (30 mL) was added sodium borohydride (5.40 mol), and the mixture was stirred at room temperature for 1 h. Water was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with brine and dried on anhydrous sodium sulfate. The solvent was removed under reduced pressure to afford 9.9 mmol of 3 (see Scheme 1).

Preparation of I from 3

One-pot Boronylation and Cvclization with Distillation

[0209] To a solution of 3 (4.88 mmol) in toluene (20 mL) was added triisopropyl borate (2.2 mL, 9.8 mmol), and the mixture was heated at reflux for 1 h. The solvent, the generated isopropyl alcohol and excess triisopropyl borate were removed under reduced pressure. The residue was dissolved in tetrahydrofuran (10 mL) and cooled to - 78 0C. n- Butyllithium (3.2 mL, 5.1 mmol) was added dropwise over 10 min, and the mixture was stirred for 1 h while allowing to warm to room temperature. The reaction was quenched with 2N HCl, and extracted with ethyl acetate. The organic layer was washed with brine and dried on anhydrous sodium sulfate. The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography to give 1.54 mmol of I.

5-bromo-6-(hvdroxymethyl)benzofcJ [1 ,2Joxaborol-l (3H)-ol (C4) [0210] M.P. >257 0C. Exemplary starting material: (2,5-dibromo-4- (methoxymethyl)phenyl)methanol.

N- fl -hydroxy- 1 ,3-dihvdrobenzofc] [1 ,2Joxaborol-6-yl)benzenesulfonamide (C 5) [0211] M.P. 175-184 0C. Exemplary starting material: 6- aminobenzo[c] [ 1 ,2]oxaborol- 1 (3H)-ol. 7-fhvdroxymethyl)benzo [c] [ 1 ,2] oxaborol- 1 (3H)-ol ( C6)

[0212] M.P. 241-250 0C. Exemplary starting material: (2-bromo-l,3- phenylene)dimethanol.

6-amino-5-fluorobenzo [c] [ 1 ,2] oxaborol- 1 (3H)-ol (C 7)

[0213] M.P. 142-145 0C. Exemplary starting material: 6-nitro-5- fluorobenzo[c] [ 1 ,2]oxaborol- 1 (3H)-ol.

5-chloro-l3-dϊhvdro-l-hvdroxy-2,l-benzoxaborole (C 8)

EXAMPLE 6

[0214] Experiments to isolate mutant leucyl tRNA transferase molecules that were also resistant to Cl.

[0215] The haploid wild type Saccharomyces cerevisiae strain ATCC 201388 (MATa his3Δl leu2Δ 0 met5Δ 0 ura3Δ 0) was used for selection of clones showing resistance to Cl.

[0216] Mutations in the leucyl tRNA transferase were isolated in two ways. In one set of experiments, EMS was used as a chemical mutagenic agent. 2.5mL of an overnight culture was washed 2x with 5OmM potassium phosphate buffer, pH 7.0, and resuspended in 10 mL of the buffer to reach approximately 5xlO7 cells/ml. 300μL EMS (Alfa Aesar, Ward Hill, MA) was added to the cells, which were then incubated for 30 min at 300C with shaking. The mutagenesis process was halted with the addition of 10% (w/v) sodium thiosulfate (Sigma- Aldrich, St. Louis, MO, USA). At the end of the mutagenesis cycle, the cells were washed 2x with water and then plated out on YPD agar plates containing Cl.

[0217] In the second method, spontaneous mutant clones were isolated from YPD plates containing large concentrations of Cl. Wild type haploid S. cerevisiae strain ATCC201388 (MATa his3Δl leu2Δ 0 met5Δ 0 ura3Δ 0) was grown overnight in Difco YPD broth (1% yeast extract, 2% Bacto Peptone, 2% glucose) at 300C to reach ~ 1.OxIO8 cells/ml. Cells were concentrated 10x in YPD broth, and lOOμL was plated out onto each of 30 YPD agar (Difco YPD broth+1.5% Bacto agar) plates containing 1.6, 3.2, 6.4μg/ml Cl (equivalent to 4x,8x, and 16x minimal inhibitory concentration of Cl). Resistant mutants appeared after 2 days of incubation at 300C. Frequency of resistance was determined by counting the number of the mutants, and the total number of cells.

[0218] The minimal inhibitory concentration (MIC) test was performed using NCCLS protocol. Yeast mating experiment was conducted following the procedure in Methods in Enzymology by Guthrie, C etc.

[0219] The genomic plasmid library for each clone was constructed using the yeast- E.coli shuttle vector pRS315 and transformed into S. cerevisiae ATCC201388. Transformants were selected on synthetic defined media with 0.2ug/ml Cl minus leucine. All sequencing work was done by Sequeteq. Blast search was performed using Saccharomyces genome database. Yeast Transformation was carried out using LiAc/PEG method. Over-expression of CDC60 construct was made by using S. cerevisiae genomic DNA, and two primers 5'GAGGGATCCGGTTAGT

TTTAGTTCGCGAGTGACC TG 3', 5 'GAGGTCGACGATTTCTGGTTGCT GTTTATTGATCTT 3'.

[0220] A total of 23 Cl resistant mutants were isolated from S. cerevisiae. All mutants were dominant and had 8-64 fold increased resistance to Cl over wildtype in the minimal inhibitory concentration test. Further characterization of these mutants showed that they were not cross resistant to any anti-fungal agents with known mechanism of action.

Determination of dominance/recessiveness

[0221] In order to identify the resistant gene in mutant strain, we first determined whether the mutation is dominant or recessive. The mutant was mated with a wild type strain with opposite mating type to make mutant diploid. There were two sets of genes in the resulting mutant diploid cells, one from resistant mutant, and the other one from the Cl -sensitive wild type. If the mutant diploid was resistant to Cl, the muted gene was dominant. To map the mutation, we constructed a plasmid library from the mutant strain, and transformed the library into the Cl -sensitive wild type strain to select for the resistant phenotype. If the mutant diploid was sensitive to Cl, the muted gene would be identified as recessive. A12, F4, H4 was mated with a wild type strain, respectively, as control; the parental strain was also mated with the same strain. Minimal inhibitory concentrations of both wild type diploid and 3 mutant diploids are shown in Table 3. Compared to wild type diploid, all 3 mutant diploids were resistant to Cl, indicating that the resistant mutation in these 3 mutants is dominant.

Genetic mapping of mutation

[0222] All the mutations in the 23 isolated Cl resistant mutants were mapped to 11 residues in the editing domain of CDC60, the cytoplasmic leucyl-tRNA synthetase.

[0223] To identify the mutation in the resistant mutant, we constructed 3 plasmid genomic libraries from mutant A12, F4 and H4, respectively. Plasmids with random genomic DNA fragment insert, size from 4- 10kb, were transformed back into parental wild type strain. Transformants with plasmids carrying resistant genes were selected on SDM-leu agar plates with addition of Cl. Plasmids were then isolated and sent for sequencing. Nucleotide sequence of the insert was BLAST searched against S. cerevisiae genome database, and the results revealed that there was a single ORF present in the insert of both plasmids isolated from F4 and H4 plasmid library. This ORF was identified as CDC60, the cytoplasmic leucyl tRNA synthetase, one of the 20 essential cytoplasmic aminoacyl-tRNA synthetases in S. cerevisiae (there are 20 more in mitochondrial). In addition to CDC60, there was a second ORF pet20 present in the plasmid isolated from Al 2 plasmid library, which encoded the protein required for respiratory growth and stability of the mitochondrial genome. To confirm that the CDC60 from these 3 mutants conferred resistance to Cl, we re -trans formed the 3 plasmids back to parental wild type strain. Compared to the control transformation of the plasmid without CDC60, ones with CDC60 from A12, F4, H4 gave >l,000 more resistant colonies on YPD agar containing Cl, confirming that CDC60 from the 3 mutant strains contributed to Cl resistance.

Sequence in CDC60 from each of the mutants contains single amino acid substitution [0224] In order to identify whether there were any amino acid substitutions, the whole ORF of CDC60 from resistant plasmids A12, F4, and H4 was sequenced. Comparing the sequence with wild type CDC60 showed that there was a single amino acid substitution in each of the 3 CDC60 (Table 4). In addition, sequence analysis of CDC60 from the rest of 20 resistant mutants showed that each contains a single amino acid change within CDC60. DNA PCR fragments containing each mutation were transformed back into wild type strain. These transformations conferred resistance, indicating that the resistance of all the mutants was due to the single amino acid substitution in CDC60. [0225] CDC60 (leucyl tRNA synthetase) is one of the aminoacyl-tRNA synthetases (ARS) that belong to a family of essential enzymes that attach amino acids to the 2', or 3 ' end of tRNAs, the charged tRNAs are then used in protein synthesis. The aminoacylation of tRNA is a two-step reaction: a) activation of amino acids with ATP by forming aminoacyl adenylates and b) transferring of the aminoacyl residue from the aminoacyl adenylate to the cognate tRNA substrate. The accuracy of aminoacylation depends on both the specific recognition of amino acids during their activations (coarse sieve) and the pre- or post transferring editing (fine sieve). Some of the ARS have evolved editing mechanism that specifically hydrolyzes structurally close related misactivated amino acids. Leucyl tRNA synthetase is one of such enzymes that can discriminate leucine from isoleucine, and valine. The region that carries out this editing function is called connective polypeptide 1 (CPl), it's a large insertion that interrupts the active site between the third and fourth b strands of the Rossman fold. All of the 11 amino acid substitutions from 23 mutants were located in this CPl region, suggesting that there might be a link between the editing function of the enzyme and inhibition activity of Cl.

EXAMPLE 7

Assay for determining that Cl inhibits the editing domain of tRNA synthetase in a bacteria

[0226] This example sets forth a representative assay for determining whether a particular compound inhibits the editing domain of an ARS in a bacterium.

[0227] The [3H] -isoleucine mischarged tRNAleu was synthesized by incubating 1 μM of Saccharomyces cerevisiae editing defective CdcβOp (C326F) in 500 μL of 5OmM Tris- HCl (pH 8.0), 6OmM MgCl2, 4mM ATP, ImM DTT, 0.02% (w/v) BSA, 4mg/mL crude E.coli tRNA tRNA (Roche), O.lmM isoleucine and 5 mCi L-[4,5-3H]isoleucine (lOOCi/mmole, GE Healthcare) and 20% (v/v) DMSO for 1 hour at 300C. The reaction was stopped by adding 10 μL of 10% (v/v) acetic acid followed by two acidic phenol (Sigma) extractions. The mischarged tRNA in the top aqueous phase was removed and precipitated by adding two volumes of 96% (v/v) ethanol and incubating at -200C for 30 minutes. The precipitate was pelleted by centrifugation at 13,200 xg for 30 minutes and the mischarged tRNA pellet was washed twice with 70% (v/v) ethanol and then resuspended in 50 mM potassium phosphate buffer pH 5.2. [0228] The reaction was terminated after 2 hours incubation at 300C by the addition of acetic acid to 0.17 % (v/v). The isoleucylated crude tRNALeu was purified by extracting twice with acidic phenol-chloroform extractions (pH 4.3), followed by ethanol precipitation. The tRNA pellet was washed twice with 70% ethanol, dried and then resuspended in 50 mM potasium phosphate (pH 5.0) and stored at -200C. An aliquot was precipitated with 10% (w/v) TCA to quantify ile-tRNALeu.

[0229] Post-transfer editing hydrolysis assays were carried out at 300C in 50 mM Hepes (pH 8), 10 mM MgCl2, 3OmM KCl, with 3H-isoleucine-tRNA crude (-0.3 μCi/mL). Each reaction was initiated by addition of the 150 nM enzyme. At each time point three 20 μL aliquots of the reaction mixture was added to 200 μL of 10% (w/v) TCA in a Millipore filter plate and precipitated for 20 minutes at 4C. The precipitate was filtered and washed three times with 200 μL of 5% (w/v) TCA, then dried and 20 μL Supermix scintillation cocktail was added. The Millipore filter plates were counted in the MicroBeta Trilux. The IC50 was determined by the amount of inhibitor that inhibited 50% activity, 100% post-transfer editing was calculated by taking the activity of the no enzyme control from the wild-type enzyme activity.

[0230] Compare the minimal inhibitory concentration (MIC) of a tolC Escherichia coli strain bearing a pUC derived plasmid with and without an leuS gene insert.

[0231] If the MIC of the strain bearing the extra copies of leuS is greater than 2-fold more than the control strain then pour LB agar plates with four times the concentration of the MIC of the compound.

[0232] Plate 1 x 1010 E. coli on ten plates containing 4 x MIC of the compound. Incubate for 1-2 days at 37C and pick ten colonies and restreak on 4 x MIC LB agar plates to confirm resistance.

[0233] Take one large colony from each of the ten E. coli resistant mutants and resuspend in 50 μL of PCR buffer.

[0234] Amplify the editing domain of CDC60 using a proof-reading PCR enzyme and the following primers, ggcaccgtggacgtacgacaacatcgc and gggaaacaccccagtcgcgcaggcgg.

[0235] Purify the 980 bp PCR product using either Qiagen or Promega PCR cleanup kits. [0236] Sequence amplify the mutant DNA and compared it to wild-type. If the mutant DNA bears mutations in the editing domain the inhibitor affects leucyl-tRNA synthetase via the editing domain.

[0237] While the invention has been described in conjunction with the exemplary embodiments described above, many equivalent modifications and variations will be apparent to those skilled in the art when given this disclosure. Accordingly, the exemplary embodiments of the invention set forth are considered to be illustrative and not limiting. Various changes to the described embodiments may be made without departing from the spirit and scope of the invention.

Non-Patent Citations
Reference
1 *See references of EP2066789A4
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
WO2016001834A1Jun 30, 2015Jan 7, 2016Daiichi Sankyo Company, LimitedTricyclic benzoxaboroles as antibacterial agents
US9138002Feb 18, 2014Sep 22, 2015Agrofresh Inc.Compounds and compositions
US9426996Jun 2, 2014Aug 30, 2016Agrofresh Inc.Use of benzoxaboroles as volatile antimicrobial agents on meats, plants, or plant parts
Classifications
International ClassificationC12N9/22
Cooperative ClassificationC12N9/93, C07K2299/00
European ClassificationC12N9/93
Legal Events
DateCodeEventDescription
Aug 6, 2008121Ep: the epo has been informed by wipo that ep was designated in this application
Ref document number: 07870156
Country of ref document: EP
Kind code of ref document: A2
Mar 31, 2009NENPNon-entry into the national phase in:
Ref country code: DE