WO2013048255A2

WO2013048255A2 - Heat tolerance microrna

Info

Publication number: WO2013048255A2
Application number: PCT/NL2012/050688
Authority: WO
Inventors: Yu-ke HE; Marinus Willem Prins; Xiang Yu
Original assignee: Keygene N.V.; Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences
Priority date: 2011-09-30
Filing date: 2012-10-01
Publication date: 2013-04-04
Also published as: WO2013048255A3

Abstract

The present invention discloses a novel miRNA that is involved in the heat stress response of plants. Downregulation of said miRNA, upregulation of its target(s), reducing or eliminating binding of said miRNA to its target(s), and/or reducing or eliminating cleavage of said target(s) by said miRNA provide strategies to improve heat tolerance in said plants. Also disclosed are strategies to downregulate said miRNA, upregulate said target(s), to reduce or eliminate binding of said miRNA to its target(s) and/or cleavage of said target(s) by said miRNA.

Description

Title: Heat Tolerance MicroRNA

Field of the invention

The present invention is in the field of agriculture, more in particular in the field of heat tolerant plants. Background

Brassica is a genus of plants in the mustard family (Brassicaceae). The members of the genus may be collectively known either as cabbages, or as mustards. Crops from this genus are sometimes called cole crops, which is derived from the Latin caulis, meaning stem or cabbage. This genus is remarkable for containing more important agricultural and horticultural crops than any other genus. It includes over 30 wild species and hybrids, and numerous additional cultivars and hybrids of cultivated origin. Most are annuals or biennials, but some are small shrubs. Due to their agricultural importance, Brassica plants have been the subject of much scientific interest. Six particularly important species {Brassica carinata, B. juncea, B. oleracea, B. napus, B. nigra and β. rapa) are derived by combining the

chromosomes from three earlier species. The genus is native in the wild in western Europe, the Mediterranean and temperate regions of Asia. In addition to the cultivated species, which are grown worldwide, many of the wild species grow as weeds, especially in North America, South America, and Australia.

The species Brassica rapa includes various vegetable crops. The comparative genomic study reveals the conserved linkage arrangements and collinear chromosome segments between B. rapa and A. thaliana, which diverged from a common ancestor approximately 13 to 17 million years ago. The B. rapa genome contains triplicated

homologous counterparts of the corresponding segments of the A. thaliana genome due to triplication of the entire genome (whole genome triplication). Production of these vegetable crops is usually impaired by heat stress in many regions. Worldwide, extensive agricultural losses are attributed to heat, often in combination with drought or other stresses. Although heat-resistant molecular breeding has been possible, genetic improvement of crops is puzzled by lack of genetic resources on heat resistance.

Plant endogenous small non-coding RNAs (ncRNAs) are involved as regulators of many endogenous processes as well as in plant responses to (abiotic) stresses, and are divided into four categories: microRNAs (miRNAs), trans-acting small interfering RNAs (ta- siRNAs), natural antisense transcripts siRNAs (nat-siRNAs) and repeat associated siRNAs (ra-siRNAs). Plant canonical miRNAs are -21 nt small RNAs that are processed by DCL1/HYL1 complex from stem-loop precursors, and are loaded to the RISC-complex for regulating plant development and stress-response. Recently, a more complex mechanism of miRNA processing in plants and animals was identified. Most known miRNA are derived from intergenic regions, while some of them are produced from introns (called mirtron), exon, TE (transposable elements) or even tRNA. Meanwhile, more evidence for crosstalk between the miRNA pathways and other siRNA pathways has also been reported. For example, the secondary small interfering RNAs (siRNAs) are triggered by 22-nt miRNA rather than by canonical 21 -nt miRNA. The miRNA hairpins are also processed by DCL3/RDR2 pathway to produce 24-nt siRNA. miRNA is known to function in cleaving target gene mRNAs and inhibiting translation, whereas 24-nt siRNAs from the miRNA precursors are involved in the methylation of the target genes, thereby inhibiting gen(om)e expression at the transcriptional level. On the other hand, miRNA-targeted genes have been identified by high throughput degradome sequencing in Arabidopsis and rice. miRNAs and their targets play a very important role in vegetative phase and floral transition, hormone biosynthesis and signalling, polarity formation and morphogenesis. Others function in stress resistance such as drought, over-oxidation and phosphate starvation. One of miRNA associated with stress tolerance was miR398, the expression of which is transcriptionally down-regulated by oxidative stresses. In Arabidopsis, miR398 was found to target the two closely related Cu/Zn superoxide dismutase-coding genes CSD1 and CSD2, and to regulate the plant tolerance to oxidative stress conditions. However, the genome-wide analysis for miRNAs under heat stress conditions has not been reported. In general, identification of conserved and novel heat- responsive miRNAs could advance our understanding of their functions in heat resistance of plants.

Heat stress disturbs cellular homeostasis and can lead to leaf etiolation, severe retardation in growth and development, and even death. The accumulation of heat shock proteins (HSPs) under the control of heat stress transcription factors (HSFs) is assumed to play a central role in the heat stress response (HSR) and in acquired thermotolerance in plants. Several proteins such as DREB2A, MBF1 C and CTL1 were validated to improve the heat resistance of plant when over-accumulated. Some signal pathways such as ethylene, ABA, H202 and IP3 crosstalk with the plant thermotolerance. How these proteins protect specific critical targets and whether small RNAs regulate these proteins are major open questions.

With the technological development of small RNA deep sequencing, many miRNAs have been discovered in various crops. The species B. rapa is one of the crops that is most closely related to the model plant Arabidopsis thaliana. Vegetable crops belonging to B. rapa are very sensitive to heat stress. Losses in the yield and quality of these crops occur especially in summer and in warm regions. Recently, great progress has been made in the sequencing and annotating of B. rapa genomes, making it possible to conduct a global-wide survey of imiRNAs in β. rapa. Identification of heat-responsive miRNAs offers the opportunity to understand mechanisms of plant response to heat stress.

MiRNAs comprise a large conserved class of non-coding RNAs that regulate cellular gene expression at the posttranscriptional level in eukaryotes. The miRNAs are synthesized as primary miRNAs (pri-miRNAs) that fold into a complex partially double stranded structure which is subsequently cleaved into a precursor-miRNA (pre-miRNA) of about 70 nucleotides which includes the miRNA teamed up with its miRNA* counterpart in a partially base pairing hairpin structure. The pre-miRNA is further processed into an imperfect miRNA/miRNA* duplex of 19 nucleotides plus two 3' overhanging non-paired nucleotides (signature of the dicer-type RNase III endoribonuclease activity). The single stranded mature miRNA as part of a mature RISC complex is used to bind mRNA targets. Depending on the extent of base pairing of the two molecules, the mRNA can be silenced by cleavage or can be translationally repressed. Plant miRNAs generally trigger target mRNA degradation by base pairing with near-perfect complementary mRNA targets.

There is a need in the art to provide for plants, in particular vegetable plants, that are more tolerant to heat than the presently available plants.

Summary of the invention

The present invention relates to an isolated nucleic acid molecule comprising

(a) a nucleotide sequence as shown in SEQ ID NO: 1 or a precursor thereof as shown in SEQ ID NO:2;

(b) a nucleotide sequence which is the complement of (a);

(c) a nucleotide sequence which has an identity of at least 80% to a sequence of (a) or (b); and/or

(d) a nucleotide sequence which hybridizes under stringent conditions to a sequence of (a), (b) and/or (c).

The identity of sequence (c) may be at least 85%, preferably at least 90%, yet more preferably at least 95% to the nucleotide sequence of (a) or (b).

The invention further pertains to a nucleotide sequence encoding a nucleic acid molecule of the present invention.

The invention also relates to a chimeric gene comprising a promoter active in plant cells operably linked to a nucleotide sequence encoding a nucleic acid molecule of the present invention and, optionally, further operably linked to a 3' untranslated nucleic acid molecule, as well as a vector comprising the nucleic acid molecule of the present invention or the chimeric gene of the present invention, and a host cell comprising such the chimeric gene or vector. The host cell may be a plant cell. Plants or parts thereof comprising such plant cell are also encompassed, as are seeds derived from such plant.

In a further aspect, the invention is concerned with use of the vector of the invention for the transformation of plant cells to provide heat tolerant plants.

In another aspect, the present invention pertains to a method for preparing a plant and/or a part thereof with improved heat tolerance, said method comprising the step of decreasing the level of the nucleic acid sequence having SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:1 , and/or decreasing the binding capacity of said nucleic acid sequence having SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:1 to its target and/or decreasing the capacity of said nucleic acid sequence having SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:1 to cleave its target in said plant.

In an embodiment, the step of decreasing the level of the nucleic acid sequence having SEQ ID NO: 1 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO: 1 , and/or decreasing the binding capacity of said nucleic acid sequence having SEQ ID NO: 1 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:1 to its target and/or decreasing the capacity of said nucleic acid sequence having SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO: 1 to cleave its target in said plant, in said plant comprises one or more steps selected from the group consisting of:

- introducing a nucleotide sequence which is the complement of the nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to the complement of the nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2 into said plant;

- downregulating expression of the gene encoding a nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2;

- mutating the gene encoding a nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO: 1 or a precursor thereof as shown in SEQ ID NO:2 as to reduce or eliminate binding of SEQ ID NO:1 to its mRNA target and/or to reduce or eliminate cleaving of the mRNA target after binding of SEQ ID NO:1 thereto; - contacting said plant with a compound capable of decreasing transcription of the gene encoding a nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to said gene; and

- contacting said plant with a compound capable of inhibiting the nucleotide sequence as shown in SEQ ID NO: 1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2.

In an embodiment, the mRNA target is mRNA corresponding to the QQT1 or the FRA-8 gene.

The invention is also concerned with a method for producing a plant and/or a part thereof with improved heat tolerance, said method comprising the step of increasing the level of mRNA corresponding to the nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, and/or of mRNA corresponding to a nucleic acid sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5; and/or decreasing the binding capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:3 or of mRNA corresponding to a nucleotide sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, to SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 ; and/or decreasing the capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:3 or of mRNA

corresponding to a nucleotide sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, to be cleaved by the nucleotide sequence of SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 , in said plant.

In an embodiment of this method, the step of increasing the level of mRNA

corresponding to a nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, and/or of mRNA corresponding to a nucleic acid sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5; and/or decreasing the binding capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:3 or of mRNA corresponding to a nucleotide sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, to the nucleotide sequence of SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 ; and/or decreasing the capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:3 or of mRNA

corresponding to a nucleotide sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, to be cleaved by SEQ ID NO: 1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 , in said plant comprises one or more steps selected from the group consisting of:

- overexpressing the nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, or a nucleic acid sequence encoding the protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, in said plant; and

- mutating a gene encoding an mRNA corresponding to the nucleotide sequence as shown in SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, or a nucleic acid sequence encoding the protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, as to reduce or eliminate binding of SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 to mRNA corresponding to the nucleotide sequence of SEQ ID NO:3 or said nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, or to mRNA corresponding to said nucleic acid sequence encoding the protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5; and/or to reduce or eliminate cleaving of mRNA corresponding to the nucleotide sequence of SEQ ID NO:3 or said nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, or of mRNA

corresponding to a nucleic acid sequence encoding the protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, after binding of SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 thereto.

In one embodiment, in a method according to the invention comprising the step of mutating the gene encoding an mRNA corresponding to a nucleotide sequence as shown in SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, and/or a nucleotide sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, comprises mutating a nucleotide sequence comprising SEQ ID NO:47 or a nucleotide sequence which has an identity of at least 85% to the nucleic acid sequence of SEQ ID NO:47.

In another embodiment, the invention pertains to a method for producing a plant and/or a part thereof with improved heat tolerance, said method comprising the step of increasing the level of mRNA corresponding to the nucleic acid sequence having SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, and/or of mRNA corresponding to a nucleic acid sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6; and/or decreasing the binding capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:4 or of mRNA corresponding to a nucleotide sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, to SEQ ID NO: 1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 ; and/or decreasing the capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:4 or of mRNA corresponding to a nucleotide sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, to be cleaved by SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 , in said plant.

In an embodiment, the step of increasing the level of mRNA corresponding to a nucleic acid sequence having SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, or of mRNA corresponding to a nucleic acid sequence encoding the protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, and/or decreasing the binding capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:4 or of imRNA

corresponding to a nucleotide sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, to SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 ; and/or decreasing the capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:4 or of mRNA corresponding to a nucleotide sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, to be cleaved by SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 , in said plant comprises one or more steps selected from the group consisting of:

- overexpressing the nucleic acid sequence having SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, or a nucleic acid sequence encoding the protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6 in said plant; and

- mutating a gene encoding an mRNA corresponding to the nucleotide sequence as shown in SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, or a nucleic acid sequence encoding the protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, as to reduce or eliminate binding of SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO: 1 to mRNA corresponding to SEQ ID NO:4 or said nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, or to mRNA corresponding to said nucleic acid sequence encoding a protein having the amino acid sequence of SEQ ID NO:6 or a protein which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6; and/or to reduce or eliminate cleaving of mRNA corresponding to SEQ ID NO:4 or said nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, or of mRNA corresponding to said nucleic acid sequence encoding the protein having the amino acid sequence of SEQ ID NO:6 or a protein which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, after binding of SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 thereto. Finally, the invention is concerned with use of a nucleic acid molecule of the invention, or a gene encoding such nucleic acid molecule, for modulating heat tolerance of a plant, in a method for genetic analysis or marker assisted selection for providing heat tolerant plants, or in a method of plant breeding for providing heat tolerant plants.

Description of figures

The invention will hereinafter be explained using the following figures, in which:

Figure 1 shows the length distribution of small RNAs in two databases of non-heading Chinese cabbage after HT (heat-treated) and NT (non-heat-treated) treatments. NT1 and HT1 are two types of small RNA datasets derived from NT and HT treatments in experiment 1 ; and NT2 and HT2 are two types of small RNA datasets derived from NT and HT treatments in experiment 2.

(A) Length distribution of total reads in NT and HT small RNA datasets.

(B) Length distribution of unique sequences in NT and HT small RNA datasets.

Figure 2 shows accumulation of bra-miR398a and expression of its target BracCSDI under non-stress conditions and heat stress conditions.

(A) Alignment of bra-miR398 with the target site of BracCSDI.

(B) Northern blotting of bra-miR398a in the seedlings of Chinese cabbage, using two biological replicates of NT and HT, respectively. C, Real-time PCR showing the expression of BracCSDI, with three biological replicates.

Figure 3 shows heat-responsive small RNAs originated from miRNA precursors. The mature miRNAs are underlined with a forward arrow while the miRNA* is indicated with a reverse arrow. Arabic numbers following the sequences are the normalized reads of small RNAs in the NT1 and HT1 libraries, and in the NT2 and HT2 libraries.

(A) Position and abundances of small RNAs originating from the bra-miR156h-2 precursor.

(B) Position and abundances of small RNAs originating from the bra-miR167a-2 precursor.

(C) Position and abundances of small RNAs originating from the bra-miR400 precursor.

Figure 4 shows the inverse expression pattern between bra-miR1885b.3 and the putative target genes under heat stress.

(A) Three pairs of miRNA/miRNA* in the loop hairpin of bra-miR-1885b.3 precursor.

(B) Abundance of the miRNAs and miRNA* derived from the bra-miR1885b.3 precursor under heat stress in 4 small RNA libraries.

(C) Alignment of bra-miR-1885b.3 with complementary site of predicted targets.

(D) Northern blotting of miR-1885b.3 under heat stress.

(E) RT-PCR showing expression of the putative target genes under heat stress. Figure 5 shows evolutional relationship and heat-response of bra-miR10 and its target bracPAPI O.

(A) Alignment of bra-miR10 precursors with BracPAPIO. The reverse sequence and direction of bra-miR10 were indicated with reverse arrow, while the DNA sequence of BracPAPIO was underlined with forward arrow. Arabic numbers after the sequences are the normalized reads of small RNAs in the order of NT1 , HT1 NT2 and HT2 datasets.

(B) Heat-responsive small RNAs originated from bra-miR10 precursors.

(C) Expression of the target BracPAPIO under heat stress, revealed by RT-PCR. (D) 5'-RACE PCR showing the cleavage sites of bra-miR10 in BracPAPIO transcript.

Figure 6 shows evolutional relationship between two novel miRNA and their validated targets.

(A) Alignment of bra-miR4 precursors with BracDRLI; The DNA sequence and direction of bra-miR4-3p were indicated with forward arrow, while the reverse complementary DNA sequence of bracDRLI was underlined with reverse arrow.

(B) 5'-RACE PCR showing the cleavage sites of bra-miR4-5p in BraVELI mRNA and of bra-miR4-3p in BraDRLI mRNA from the genes of which the miRNA precursors are evolved from.

(C) Alignment of bra-miR9b precursor with BracTAOI. The forward arrow indicates bra-miR9.1 while the reverse arrow shows the reverse complementary DNA sequence of BracTAOI.

(D) 5'-RACE PCR showing the cleavage site of bra-miR9.1 in the target BracTAOI where the miRNA precursor is evolved from.

Figure 7 shows constructs used for heat tolerance identification of miR-1885b.3 and its target QQT1 (Example 2).

Definitions

A "nucleic acid", "nucleic acid molecule", "nucleic acid sequence", or "nucleotide sequence" according to the present invention may include any polymer or oligomer of pyrimidine and purine bases, preferably cytosine, thymine, and uracil, and adenine and guanine, respectively (See Albert L. Lehninger, Principles of Biochemistry, at 793-800 (Worth Pub. 1982) which is herein incorporated by reference in its entirety for all purposes). The present invention contemplates any deoxyribonucleotide, ribonucleotide or peptide nucleic acid component, and any chemical variants thereof, such as methylated, hydroxymethylated or glycosylated forms of these bases, and the like. The polymers or oligomers may be heterogenous or homogenous in composition, and may be isolated from naturally occurring sources or may be artificially or synthetically produced. In addition, the nucleic acids may be DNA or RNA, or a mixture thereof, and may exist permanently or transitionally in single- stranded or double-stranded form, including homoduplex, heteroduplex, and hybrid states.

An "isolated nucleic acid sequence" refers to a nucleic acid sequence which is no longer in the natural environment from which it was isolated, e.g. the nucleic acid sequence in a bacterial host cell or in the plant nuclear or plastid genome.

"Complement" or "complementary" as used herein may mean Watson-Crick or Hoogsteen base pairing between nucleotides or nucleotide analogs of nucleic acid molecules.

The term "gene" means a DNA sequence comprising a region (transcribed region), which is transcribed into a RNA molecule (e.g. an mRNA) in a cell, operably linked to suitable regulatory regions (e.g. a promoter). The transcribed region of a gene may be a nucleotide sequence coding for an amino acid sequence or a functional RNA, such as tRNA, rRNA, catalytic RNA, siRNA, miRNA, and antisense RNA. A gene may thus comprise several operably linked sequences, such as a promoter, a 5' leader sequence comprising e.g. sequences involved in translation initiation, translated regions (exons), introns, and a 3' non- translated sequence comprising e.g. transcription termination sites.

A "chimeric gene" (or recombinant gene) refers to any gene, which is not normally found in nature in a species, in particular a gene in which one or more parts of the nucleic acid sequence are present that are not associated with each other in nature. For example the promoter is not associated in nature with part or all of the transcribed region or with another regulatory region. The term "chimeric gene" is understood to include expression constructs in which a promoter or transcription regulatory sequence is operably linked to one or more coding sequences or to an antisense (reverse complement of the sense strand) or inverted repeat sequence (sense and antisense, whereby the RNA transcript forms double stranded RNA upon transcription).

A "3' UTR" or "3' non-translated sequence" (also often referred to as 3' untranslated region, 3' non-translated region or 3'end) refers to the nucleic acid sequence found downstream of the coding sequence of a gene, which comprises for example a transcription termination site and (in most, but not all eukaryotic mRNAs) a polyadenylation signal (such as e.g. AAUAAA or variants thereof). After termination of transcription, the mRNA transcript may be cleaved downstream of the polyadenylation signal and a poly(A) tail may be added, which is involved in the transport of the mRNA to the cytoplasm (where translation takes place).

"Expression of a gene" refers to the process wherein a DNA region, which is operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into an RNA, which is biologically active, i.e. which is capable of being translated into a biologically active protein or peptide (or active peptide fragment) or which is active itself (e.g. in posttranscriptional gene silencing or RNAi). An active protein in certain embodiments refers to a protein being constitutively active. The coding sequence is preferably in sense- orientation and encodes a desired, biologically active protein or peptide, or an active peptide fragment. In gene silencing approaches, the DNA sequence is preferably present in the form of an antisense DNA or an inverted repeat DNA, comprising a short sequence of the target gene in antisense or in sense and antisense orientation. "Ectopic expression" refers to expression in a tissue in which the gene is normally not expressed.

A "transcription regulatory sequence" is herein defined as a nucleic acid sequence that is capable of regulating the rate of transcription of a (coding) sequence operably linked to the transcription regulatory sequence. A transcription regulatory sequence as herein defined will thus comprise all of the sequence elements necessary for initiation of transcription (promoter elements), for maintaining and for regulating transcription, including e.g. attenuators or enhancers. Although mostly the upstream (5') transcription regulatory sequences of a coding sequence are referred to, regulatory sequences found downstream (3') of a coding sequence are also encompassed by this definition.

As used herein, the term "promoter" refers to a nucleic acid fragment that functions to control the transcription of one or more genes, located upstream with respect to the direction of transcription of the transcription initiation site of the gene, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter. A "constitutive" promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An "inducible" promoter is a promoter that is physiologically (e.g. by external application of certain compounds) or developmentally regulated. A "tissue specific" promoter is only active in specific types of tissues or cells. A "promoter active in plants or plant cells" refers to the general capability of the promoter to drive transcription within a plant or plant cell. It does not make any implications about the spatiotemporal activity of the promoter.

As used herein, the term "operably linked" refers to a linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter, or rather a transcription regulatory sequence, is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the DNA sequences being linked are typically contiguous. A "nucleic acid construct" or "vector" is herein understood to mean a man-made nucleic acid molecule resulting from the use of recombinant DNA technology and which is used to deliver exogenous DNA into a host cell. The vector backbone may for example be a binary or superbinary vector (see e.g. US 5591616, US 2002138879 and WO95/06722), a co-integrate vector or a T-DNA vector, as known in the art and as described elsewhere herein, into which a chimeric gene is integrated or, if a suitable transcription regulatory sequence is already present, only a desired nucleic acid sequence (e.g. a coding sequence, an antisense or an inverted repeat sequence) is integrated downstream of the transcription regulatory sequence. Vectors usually comprise further genetic elements to facilitate their use in molecular cloning, such as e.g. selectable markers, multiple cloning sites and the like (see below).

A "host cell" as used herein may be a naturally occurring cell or a transformed cell that contains a vector and supports the replication of the vector. Host cells may be cultured cells, explants, cells in vivo, and the like. Host cells may be prokaryotic cells, or eukaryotic cells such as plant cells.

"Stringent hybridisation conditions" can be used to identify nucleotide sequences, which are substantially identical to a given nucleotide sequence. Stringent conditions are sequence dependent and will be different in different circumstances. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (T_m) for the specific sequences at a defined ionic strength and pH. The T_m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridises to a perfectly matched probe. Typically stringent conditions will be chosen in which the salt concentration is about 0.02 molar at pH 7 and the temperature is at least 60°C. Lowering the salt concentration and/or increasing the temperature increases stringency. Stringent conditions for RNA-DNA hybridisations (Northern blots using a probe of e.g. 100nt) are for example those which include at least one wash in 0.2X SSC at 63°C for 20 min, or equivalent conditions. Stringent conditions for DNA-DNA hybridisation (Southern blots using a probe of e.g. 100nt) are for example those which include at least one wash (usually 2) in 0.2X SSC at a temperature of at least 50°C, usually about 55°C, for 20 min, or equivalent conditions. See also Sambrook ei al. (1989) and Sambrook and Russell (2001 ).

"Sequence identity" and "sequence similarity" can be determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms. Sequences may then be referred to as "substantially identical" or "essentially similar" when they (when optimally aligned by for example the programs GAP or BESTFIT using default parameters) share at least a certain minimal percentage of sequence identity (as defined below). GAP uses the Needleman and Wunsch global alignment algorithm to align two sequences over their entire length, maximizing the number of matches and minimises the number of gaps. Generally, the GAP default parameters are used, with a gap creation penalty = 50 (nucleotides) / 8 (proteins) and gap extension penalty = 3 (nucleotides) / 2 (proteins). For nucleotides the default scoring matrix used is nwsgapdna and for proteins the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). Sequence alignments and scores for percentage sequence identity may be determined using computer programs, such as the GCG Wisconsin Package, Version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121 -3752 USA, or EmbossWin version 2.10.0 (using the program "needle"). Alternatively percent similarity or identity may be determined by searching against databases, using algorithms such as FASTA, BLAST, etc. Preferably, the sequence identity refers to the sequence identity over the entire length of the sequence. When comparing DNA and RNA, thymine (T) and uracil (U) are considered equivalent.

A "host cell" or a "recombinant host cell" or "transformed cell" are terms referring to a new individual cell (or organism) arising as a result of at least one nucleic acid molecule, especially comprising a chimeric gene encoding a desired protein or a nucleic acid sequence which upon transcription yields an antisense RNA or an inverted repeat RNA (or hairpin RNA) for silencing of a target gene/gene family, having been introduced into said cell. The host cell is preferably a plant cell or a bacterial cell. The host cell may contain the nucleic acid construct as an extra-chromosomally (episomal) replicating molecule, or more preferably, comprises the chimeric gene integrated in the nuclear or plastid genome of the host cell.

The term "selectable marker" is a term familiar to one of ordinary skill in the art and is used herein to describe any genetic entity which, when expressed, can be used to select for a cell or cells containing the selectable marker. Selectable marker gene products confer for example antibiotic resistance, or more preferably, herbicide resistance or another selectable trait such as a phenotypic trait (e.g. a change in pigmentation) or nutritional requirements. The term "reporter" is mainly used to refer to visible markers, such as green fluorescent protein (GFP), eGFP, luciferase, GUS and the like.

The term "ortholog" of a gene or protein refers herein to the homologous gene or protein found in another species, which has the same function as the gene or protein, but (usually) diverged in sequence from the time point on when the species harbouring the genes diverged (i.e. the genes evolved from a common ancestor by speciation). Orthologs of the gene may thus be identified in other plant species based on both sequence comparisons (e.g. based on percentages sequence identity over the entire sequence or over specific domains) and functional analysis.

The terms "homologous" and "heterologous" refer to the relationship between a nucleic acid or amino acid sequence and its host cell or organism, especially in the context of transgenic organisms. A homologous sequence is thus naturally found in the host species (e.g. a tomato plant transformed with a tomato gene), while a heterologous sequence is not naturally found in the host cell (e.g. a tomato plant transformed with a sequence from potato plants). Depending on the context, the term "homolog" or "homologous" may alternatively refer to sequences which are descendent from a common ancestral sequence (e.g. they may be orthologs).

As used herein, the term "allele(s)" means any of one or more alternative forms of a gene at a particular locus. In a diploid cell of an organism, alleles of a given gene are located at a specific location, or locus (loci plural) on a chromosome. One allele is present on each chromosome of the pair of homologous chromosomes.

The term "miR-1885b.3" encompasses the miRNA sequence as shown in SEQ ID NO:1. It may further encompass variants thereof having at least 80% identity to the nucleotide sequence depicted in SEQ ID NO:1 .

The terms "protein" or "polypeptide" are used interchangeably and refer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, 3 dimensional structure or origin. A "fragment" or "portion" of a protein may thus still be referred to as a "protein". An "isolated protein" is used to refer to a protein which is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant host cell.

The term "target" as used herein is used to denote an mRNA molecule encoding such protein or polypeptide to which a miRNA such as miR-1885b.3 binds under stringent hybridization conditions. Its expression will be downregulated as a consequence of binding of the miRNA to its mRNA, and optionally subsequent cleavage of the mRNA by binding of the miRNA thereto.

As used herein, the term "heat stress" or "heat" refers to a sub-optimal environmental condition associated with temperature. As used herein, the term "heat" refers to an environmental condition wherein the temperature of the atmosphere and/or soil is higher than optimal for growth and/or development. For example, the optimal temperature of the atmosphere for growing cabbages is in the range of 15-25°C. When the temperature is higher than that range, the cabbages are subjected to "heat stress". The effect of subjecting plants to "heat stress" may be that plants do not have optimal growth and/or development. For example, subjecting Brassica campestris L. ssp. chinensis to heat stress may have the effect of elongating internode, slowing growth, providing bitter taste, increasing fiber content etc. Subjecting Brassica campestris L. ssp. Pekinsis to heat stress during the rosette stage and the heading stage may have the effect that the heart leaf can not amplexate to built a tight bulb, or it can not bulb up at all. Even if the heart leaf constrainedly bulbs up, the heading may be loose.

The term "heat tolerant" or "heat tolerance" refers to plants which, when provided with heat tolerance (or being heat tolerant), when subjected to heat stress do not show effects or show alleviated effects as observed in plants not provided with heat tolerance. Said plants not provided with heat tolerance are preferably of the same genetic background. The terms "heat tolerant" and "heat resistant" are used interchangeably. When a plant is "heat tolerant", it is capable of sustaining normal growth and/or normal development when being subjected to a high temperature that otherwise would have resulted in reduced growth and/or

development normal plants. Hence, heat tolerance is a relative term determined by comparing plants with another plant, whereby the plant most capable of sustaining (normal) growth may be a "heat tolerant" plant, whereas the plant less capable may be termed a "heat sensitive" plant. Providing heat tolerance thus is understood to include improving the heat tolerance of a plant, when compared with a plant of the same genetic background not provided with heat tolerance. Thus, a plant having improved heat tolerance is more tolerant to heat than a plant of the same genetic background which is not modified according the invention.

As used herein, the term "modulating heat tolerance" refers to suppressing, reducing, decreasing, impairing, inducing, conferring, restoring, elevating, increasing, improving or otherwise affecting the heat tolerance of a plant.

As used herein, the term "plant" includes plant cells, plant tissues or organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant cell clumps, and plant cells that are intact in plants, or parts of plants, such as embryos, pollen, ovules, fruit (e.g. harvested tomatoes), flowers, leaves, seeds, roots, root tips and the like.

The terms "increased level" and "decreased level" and "reduction" as used throughout this document refers to a significantly increased level or significantly decreased level. Generally, a level is increased or decreased or reduced when it is at least 5%, such as 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% higher or lower, respectively, than the corresponding level in a control. The control may be from a naturally occurring plant, preferably of the same genus and/or species, even more preferably of the same genetic background, as the modified plant of the invention.

It is to be understood that the phrase "m NA corresponding to a nucleic acid sequence" relates to gene expression, which in this context involves transcription of RNA from a DNA sequence, after which the RNA is processed and translated into a protein. It is understood that when a nucleic acid sequence is a DNA sequence, the mRNA corresponding to the nucleic acid sequence, e.g. as set forth in the sequence listing, comprises the corresponding RNA sequence, i.e., wherein in the DNA sequence listing T (or t) is changed into a U (or u), but is not limited thereto. When the nucleic acid sequence encodes a protein, it is understood the nucleic acid sequence may be an (m)RNA sequence or a DNA sequence. The nucleic acid sequences referred to with regard to the phrase "mRNA corresponding to a nucleic acid sequence" relate to the coding DNA sequences only. For example, SEQ ID NO.6 consists of 456 nucleotides and is a DNA sequence. The corresponding RNA sequence will comprise the same sequence but "t" will be replaced by "u". This RNA sequence comprises the 152 codons that are translated into the protein of SEQ ID NO.7. It is well understood that in addition to coding sequences, mRNA also comprises non-coding sequences. Non-coding sequences are, for example, but are not limited thereto, a 5' untranslated region (UTR), a 3'- UTR, a poly-A tail, and intron sequences. In the cell, gene expression involves the

transcription of RNA from DNA. In the nucleus, an mRNA is formed that way comprise in general a 5'-UTR, introns and exons and a 3'-end and poly-A tail. If an mRNA comprises introns, these are spliced out in the nucleus, and the mRNA transcript is exported out of the nucleus. The mRNA from which a protein is translated will have a contiguous coding sequence, i.e. without intron sequences, and may additionally comprise a 5'-UTR, 3'-UTR and poly-A tail. Such an mRNA sequence can be isolated and reverse transcribed into cDNA after which the coding sequence can be determined. It is thus understood that the phrase "mRNA corresponding to a nucleic acid sequence" may comprise one or more non-coding RNA sequences in addition to the RNA sequence corresponding to the nucleic acid sequence referred to. The non-coding RNA sequences may include 5'-UTR, 3'-UTR, introns and a poly-A tail. As long as an mRNA can be translated into a protein encoded by a nucleic acid sequence as referred to, optionally after further processing in the cell such as splicing, in the context of the present invention such an mRNA is considered an "mRNA corresponding to a nucleic acid sequence".

Likewise, it is also understood that a "gene encoding an mRNA corresponding to a nucleotide sequence" relates to a gene sequence comprising DNA sequences that are involved in the expression of said mRNA. Such a gene may include promoter and enhancer sequences that render the gene capable of being transcribed. Such a gene also comprises the DNA sequence which is transcribed into mRNA. When, according to the invention, a gene encoding an mRNA is mutated, resulting in mutating the mRNA corresponding to a nucleotide sequence, such that binding of a miRNA to said mRNA is reduced or eliminated (as to reduce or eliminate cleavage of said mRNA), it is understood that such a gene mutation may involve mutating a target sequence in the mRNA of said miRNA. A target sequence in the mRNA may be present in the coding sequence, but may also be present in the 5'-UTR or 3'-UTR. Examples of a DNA sequence corresponding to a target sequence for brac-CSD1 is depicted in figure 2A, i.e. 5'-aaggggtaccctgagatcaca-3' (SEQ ID NO.47) and for Brac-QQT1 as depicted in figure 4D, i.e. 5'-cttctctctttatccacaat-3' (SEQ ID N0.48). Mutating these sequences may result in a reduction or elimination of binding of the miRNA with the corresponding sequence in the mRNA.

"Complement" or "complementary" as used herein may mean Watson-Crick or

Hoogsteen base pairing between nucleotides or nucleotide analogs of nucleic acid

molecules. The term "complement" or "complementary" with regard to RNA is defined herein as nucleotides of a nucleic acid sequence that can bind to another nucleic acid sequence through hydrogen bonds, i.e. nucleotides that are capable of base pairing. Nucleotides that can form base pairs, that are complementary to one another, are e.g. cytosine and guanine, adenine and uracil, guanine and uracil. Hence, for example between a miRNA and a target sequence, a C can form a base pair with a G, a G can form a base pair with a U or C, an A can form a base pair with a U, and a U can form a base pair with an A or G.

Furthermore, when the "percentage identity" is to be determined, said complementary base pairing with regard to RNA, e.g. between a miRNA and a target sequence, may be taken into account. For example, a miRNA may have a G at a particular position and the target may have a C at the complementary position. Another target sequence may have a U (or in the case of a DNA sequence T which is transcribed into a U in the corresponding RNA) at the same position. The consequence of this difference would be that instead of a G-C base pair, a G-U base pair is formed at this position between the miRNA and its target sequence. Hence, when determining sequence identity between the two target sequences, this particular position may be regarded as being identical and not taken into account as being not identical when determining the percentage of identity between target sequences. Hence, when the only difference between the two target sequences would be the sequence difference at this position, i.e. a C or U, the two target sequences may be regarded as being 100% identical.

In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition, the verb "to consist" may be replaced by "to consist essentially of" meaning that a composition of the invention may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristics of the invention.

In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one".

Detailed description of the invention

The present inventors have identified a novel Brassica rapa heat responsive miRNA, miR-1885b.3 (also termed miR9b.3 in this text, as shown in SEQ ID NO: 1 ), which is severely downregulated in response to heat stress, whilst two of its targets (QQT1 (as shown in SEQ ID NO:5 and FRA-8 (as shown in SEQ ID NO:6)) are upregulated in response to heat stress. The present inventors have further demonstrated that in Arabidopsis thaliana downregulation of miR-1885b.3 as well as overexpression of one of its targets, QQT1 , increase heat tolerance.

MicroRNA

Without wishing to be bound by theory, the current model for the maturation of plant miRNAs is as follows. A gene encoding a miRNA may be transcribed leading to production of an miRNA precursor known as the pri-miRNA. The pri-miRNA may form at least one hairpin with a stem and loop. The stem may comprise mismatched nucleotides. Pri-miRNAs are cleaved to pre-miRNA using a Dicer-like enzyme (DCL); typically DCL1 . Then, pre-miRNA is further cleaved to a miRNA duplex (miRNA:miRNA*), a short double-stranded RNA (dsRNA), and a mature miRNA. Finally, mature miRNAs are predominantly incorporated in the RNA- induced silencing complex (RISC) in which they negatively regulate gene expression by inhibiting gene translation or degrading coding mRNAs by perfect or near-perfect

complement to target mRNAs.

Nucleic acid molecules of the invention

The present disclosure provides an isolated, recombinant or synthetic nucleic acid molecule comprising (a) a nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2; (b) a nucleotide sequence which is the complement of (a); (c) a nucleotide sequence which has an identity of at least 80% to a sequence of (a) or (b); and/or (d) a nucleotide sequence which hybridizes under stringent conditions to a sequence of (a), (b) and/or (c).

The nucleic acid molecules of the present invention are preferably capable of manipulating heat tolerance of a plant, e.g., by manipulating expression levels of at least one of the QQT1 gene and the FRA-8 gene, preferably both the QQT1 gene and the FRA-8 gene. The nucleotide sequence as shown in SEQ ID NO:1 and the nucleotide sequence which has at least 80% identity to the nucleotide sequence as shown in SEQ ID NO:1 are preferably capable of downregulating at least one of the QQT1 gene and the FRA-8 gene, preferably both the QQT1 gene and the FRA-8 gene. The nucleotide sequences of (b) and (d) may be capable of upregulating at least one of the QQT1 gene and the FRA-8 gene.

The nucleotide sequence as shown in SEQ ID NO:1 is the mature miR-1885b.3. It is 20 nucleotides in length. It has been shown to be downregulated in heat stress, whereas two of its targets are upregulated in heat stress. miR-1885b.3 does not have homology to any miRNA family identified to date. miR-1885b.3 may be downregulated by a nucleotide sequence which is its complement. The present inventors have further demonstrated that in Arabidopsis thaliana both downregulation of miR-1885b.3 and overexpression of one of its targets, QQT1 , increase heat tolerance of the plant. Also encompassed by the present invention are nucleic acid molecules which have a sequence which is complementary to the nucleotide sequence of SEQ ID NO: 1 , such as anti- sense RNA or other inhibitory RNA, e.g. such as used in RNAi; or which hybridise under stringent conditions to part of the sequence of SEQ ID NO:1. These complementary and hybridising sequences may be of any length and the skilled person will understand that the appropriate length should be adapted to the purpose for which the sequence is to be used. Preferably, these complementary and hybridising sequences are at least 15, 16, 17, 18, or 19 nucleotides in length. More preferably, these complementary and hybridising sequences are 20 nucleotides in length. It is expected that 80% identity with the nucleotide sequence of SEQ ID NO:1 will suffice to ensure binding of said complementary and/or hybridising sequences to SEQ ID NO: 1. Preferably, said complementary and hybridising sequences have an identity of at least 80%, such as at least 85%, 90%, 95%, 96%, 97%, 98%, or 99%, to the nucleotide sequence as shown in SEQ ID NO:1 , preferably over its full length.

The present disclosure also relates to a nucleotide sequence which has an identity of at least 80%, such as at least 85%, 90%, 95%, 96%, 97%, 98%, or 99%, to a sequence of (a) or (b), preferably over its full length. Identity of two nucleotide sequences is determined using the methods mentioned above in the Definitions section.

Also encompassed by the present invention is the nucleotide sequence as shown in SEQ ID NO:2, which represents the precursor miRNA of miR-1885b.3, and nucleic acid molecules which have a sequence which is complementary to the nucleotide sequence of SEQ ID NO:2, such as anti-sense RNA or other inhibitory RNA, e.g. such as used in RNAi; or which hybridise under stringent conditions to part of the sequence of SEQ ID NO:2. These complementary and hybridising sequences may be of any length and the skilled person will understand that the appropriate length should be adapted to the purpose for which the sequence is to be used. Preferably, these complementary and hybridising sequences are at least 15, 16, 17, 18, 19 nucleotides in length. It is expected that 80% identity with the nucleotide sequence of SEQ ID NO:2 will suffice to ensure binding of said complementary and/or hybridising sequences to SEQ ID NO:2. Preferably, said complementary and hybridising sequences have an identity of at least 80%, such as at least 85%, 90%, 95%, 96%, 97%, 98%, or 99%, to the nucleotide sequence as shown in SEQ ID NO:2, preferably over the full length of said complementary or hybridizing sequences.

The nucleic acid molecule disclosed herein may have a length of at least about 10 nucleotides. The nucleic acid molecule may have a length of at least 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 nucleotides. In an embodiment, the nucleic acid molecule disclosed herein may have a length of at most about 600, such as at most about 500, 400, 300, 250, 200, 150, 140, 130, 120, 1 10, 100, 90, 80, 70, 60, 50, 40, 30, or 25 nucleotides. The nucleic acid molecule may be synthesized or expressed in a cell {in vitro or in vivo).

The nucleic acid molecule of the present disclosure may comprise a sequence of a pri-miRNA or a variant thereof. The pri-miRNA sequence may form a hairpin structure.

The nucleic acid molecule of the present disclosure may comprise a sequence of a pre-miRNA (e.g., the nucleotide sequence of SEQ ID NO:2) or a variant thereof.

The nucleic acid molecule of the present disclosure may also comprise a sequence of an anti-miRNA that is capable blocking the activity of the miRNA having SEQ ID NO:1 or a variant thereof having an identity of at least 80% to SEQ ID NO:1 .

The nucleic acid molecule may also comprise a sequence of a target miRNA binding site, or a variant thereof.

The invention further pertains to nucleotide sequence encoding a nucleic acid molecule of the present invention, such as a miRNA or an anti-miRNA.

The present disclosure also provides a gene encoding the isolated nucleotide sequence as described above.

The present invention also relates to a chimeric gene encoding a nucleic acid molecule (such as, for example, pri-miRNA, pre-miRNA and/or mature miRNA, or a complement thereof) of the present invention operably linked to a promoter or transcription regulatory sequence, and optionally a 3'UTR sequence. The gene may be capable of modifying the expression of a target gene with a binding site for the nucleic acid molecule of the invention. Expression of the target gene may be modified in a cell, tissue, or organ or throughout the organism. The chimeric gene may be synthesized or derived from naturally- occurring genes by standard recombinant DNA techniques. The chimeric gene may also comprise a selectable marker.

Vectors of the present disclosure

In another aspect, the invention relates to a vector comprising a nucleic acid molecule of the present disclosure. Vectors which advantageously may be used include well-known plant vectors such as pK7GWIG2(l) and pGreen, as well as state of the art vectors used for transforming and expressing proteins in microorganisms. See also Arabidopsis, A laboratory manual Eds. Weigel & Glazebrook, Cold Spring Harbor Lab Press (2002) and Maniatis et al. Molecular Cloning, Cold Spring Harbor Lab (1982).

Host cells of the present disclosure

In yet another aspect, the invention relates to a host cell comprising a nucleic acid, chimeric gene, or a vector according to the present disclosure. Suitable host cells according to the invention include plant cells, yeast cells, fungal cells, algal cells, human cells and animal cells. Examples of suitable plant cells include, without limitation, Brassica and Arabidopsis cells. Examples of suitable yeast cells include Saccharomyces cerevisiae and Pichia pastoris. Examples of suitable fungal cells include Aspergillus. Examples of suitable animal cells include insect cells, e.g. from Spodoptera frugiperda; mammalian cells such as Chinese hamster ovary cells or PERC6 cells. A variety of state of the art cell lines may be used, such as the Flp-ln cell lines (Invitrogen). As indicated above, a variety of vectors for introducing a nucleic acid of the invention into the host cell may be used. These vectors may be cloning vectors, expression vectors, silencing vectors which may be chosen from, for example, plasmid DNA vectors, viral DNA vectors (such as adenovirus or adeno-associated vectors), viral RNA vectors (such as retroviral) or viral plant vectors, such as tobacco rattle virus and potato virus X.

In another embodiment, the host cell is a transgenic plant.

One embodiment of the invention is a non-human organism modified to comprise a nucleic acid sequence of the present invention. The non-human organism and/or host cell may be modified by any methods known in the art for gene transfer including, for example, the use of delivery devices such as lipids and viral vectors, naked DNA, electroporation, chemical methods and particle-mediated gene transfer. In an advantageous embodiment, the non-human organism is a plant.

Any plant may be a suitable host, such as monocotyledonous plants or dicotyledonous plants, but most preferably the host plant belongs to the family Brassicaceae or Cruciferae, for example, the plant belongs to the genus Brassica (e.g. β. napus, B. juncea, B. oleracea, B. rapa, etc)

Alternatively, the plant may belong to any other family, such as to the Solanaceae. Solanum (including Lycopersicon), Nicotiana, Capsicum, Petunia and other genera. The following host species may suitably be used: Tobacco (Nicotiana species, e.g. N. benthamiana, N. plumbaginifolia, N. tabacum, etc.), vegetable species, such as tomato (L. esculentum, syn. Solanum lycopersicum) such as e.g. cherry tomato, var. cerasiforme or currant tomato, var. pimpinellifolium) or tree tomato (S. betaceum, syn. Cyphomandra betaceae), potato (Solanum tuberosum), eggplant (Solanum melongena), pepino (Solanum muricatum), cocona (Solanum sessiliflorum) and naranjilla (Solanum quitoense), peppers (Capsicum annuum, Capsicum frutescens, Capsicum baccatum), ornamental species (e.g. Petunia hybrida, Petunia axillaries, P. integrifolia). or Gramineae. Suitable host plants include for example maize/corn (Zea species), wheat (Triticum species), barley (e.g. Hordeum vulgare), oat (e.g. Avena sativa), sorghum (Sorghum bicolor), rye (Secale cereale), soybean (Glycine spp, e.g. G. max), cotton (Gossypium species, e.g. G. hirsutum, G. barbadense), sunflower (Helianthus annus), safflower, yam, cassava, alfalfa (Medicago sativa), rice (Oryza species, e.g. O. sativa indica cultivar-group or japonica cultivar-group), forage grasses, pearl millet (Pennisetum spp. e.g. P. glaucum), tree species (Pinus, poplar, fir, plantain, etc), tea, coffee, oil palm, coconut, vegetable species, such as pea, zucchini, beans (e.g. Phaseolus species), cucumber, artichoke, asparagus, broccoli, garlic, leek, lettuce, onion, radish, turnip, Brussels sprouts, carrot, cauliflower, chicory, celery, spinach, endive, fennel, beet, fleshy fruit bearing plants (grapes, peaches, plums, strawberry, mango, apple, plum, cherry, apricot, banana, blackberry, blueberry, citrus, kiwi, figs, lemon, lime, nectarines, raspberry, watermelon, orange, grapefruit, etc.), ornamental species (e.g. Rose, Petunia, Chrysanthemum, Lily, Gerbera species), herbs (mint, parsley, basil, thyme, etc.), woody trees (e.g. species of Populus, Salix, Quercus, Eucalyptus), fibre species e.g. flax (Linum usitatissimum) and hemp (Cannabis sativa).

Preferred hosts are "crop plants" or "cultivated plants", i.e. plant species which is cultivated and bred by humans. A crop plant may be cultivated for food or feed purposes (e.g. field crops), or for ornamental purposes (e.g. production of flowers for cutting, grasses for lawns, etc.). A crop plant as defined herein also includes plants from which non-food products are harvested, such as oil for fuel, plastic polymers, pharmaceutical products, cork, fibres (such as cotton) and the like. Advantageously, the plants are vegetable plants, and more preferably, they belong to the family Brassicaceae.

Uses and methods for providing heat tolerant plants

The present invention is based upon the surprising finding that the novel miRNA miR-

1885b.3 downregulates expression of QQT1 (as exemplified in SEQ ID NO:5) and/or FRA-8 (as exemplified in SEQ ID NO:6) protein to provide heat tolerant plants. Similarly,

overexpression of QQT1 and/or FRA-8 protein provides heat tolerant plants. Therefore, for providing heat tolerant plants the following measures may be taken (optionally, in

combination):

1 . the expression of miR-1885b.3 may be downregulated in a plant.

2. the expression of QQT1 and/or FRA-8 protein may be upregulated in a plant.

Consequently, the resulting plant will be more heat tolerant than the native plant.

3. the interaction (or binding capacity) between miR-1885b.3 and its target mRNA

corresponding to QQT1 and/or FRA-8 may be reduced and/or eliminated. To this end, either miR-1885b.3 or its target(s) QQT1 and/or FRA-8 mRNA may be mutated as to reduce binding or ensure lack of binding of one to the other. Thus, no functional complex will be formed.

4. miR-1885b.3 and its target QQT1 and/or FRA-8 mRNA may bind with comparable affinities as compared to their binding in a native plant, but miR-1885b.3 has been mutated in such a way that it can cleave the QQT1 and/or FRA-8 mRNA sequences to a lesser extent or can no longer cleave the QQT1 and/or FRA-8 mRNA sequences, such that miR-1885b.3 has lost its function. Alternatively, the QQT1 and/or FRA-8 nucleotide sequences may have been mutated in such a way that it/they can be cleaved by miR-1885b.3 only to a lesser extent or can no longer be cleaved by miR-1885b.3.

5. the formation of mature miR-1885b.3 may be reduced by mutating the pri-miR-1885b.3 and/or pre-miR-1885b.3 in such a way that its cleavage into mature miR-1885b.3 is reduced or eliminated.

Methods for up and down regulating the expression of a polypeptide of RNA molecule in plant systems are known in the art. Upregulation is based on overexpression of the polypeptide of interest in the whole plant or in specific plant parts, such as petals and leaves.

Downregulation may take place at the DNA level, by interfering with e.g. transcription.

Alternatively, it may interfere at the RNA level, e.g. by interfering with the translocation of the RNA to the site of protein translation, or with the translation of protein from the RNA, or with the splicing of the RNA to yield one or more mRNA species. The overall effect of such interference with expression is a decrease (inhibition) in the expression of the gene. Interference on RNA level is preferred. Suitable ways to achieve interference on RNA level are through RNAi using double stranded or hairpin RNA; through silencing using siRNA; or through cosuppression. See for instance, Hammond & Hannon (2001 ) Nature Rev Gen 2: 1 10-1 19, Arabidopsis, A laboratory manual Eds. D. Weigel & J Glazebrook (2002), CSHL Press and Cogoni & Macino (2000) Genes Dev 10: 638-643.

Downregulation also includes translational and post-translational inhibition. Methods for translational and post-translational inhibition are well-known in the art.

In an aspect, the present invention relates to a method for preparing a plant and/or a part thereof with improved heat tolerance, said method comprising the step of decreasing the level of the nucleic acid sequence having SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:1 and/or decreasing the binding capacity of said nucleic acid sequence having SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:1 to its target and/or decreasing the capacity of said nucleic acid sequence having SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:1 to cleave its target in said plant. Thus, this method of the present invention is concerned with expressional or functional downregulation of mature miR- 1885b.3.

Expressional or functional downregulation of mature miR-1885b.3 may be

accomplished by one of the following:

- (optionally, stably) introducing a nucleotide sequence which is the complement of the nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to the complement of the nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2 into said plant;

- downregulating expression of the gene encoding a nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO: 1 or a precursor thereof as shown in SEQ ID NO:2;

- contacting said plant with a compound capable of decreasing transcription of the gene encoding a nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2 or a nucleotide sequence which has an identity of at least 80% to the gene encoding a nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2 (an antagonist to the coding gene of miR-1885b.3); and

- contacting said plant with a compound capable of inhibiting the nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2,or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2 (an antagonist to miR-1885b.3, pri- miR1885b.3, pre-miR1885b.3);

- mutating the gene encoding a nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO: 1 or a precursor thereof as shown in SEQ ID NO:2 as to reduce or eliminate binding of SEQ ID NO:1 or said nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 to its mRNA target and/or to reduce or eliminate cleaving of the mRNA target after binding of SEQ ID NO:1 or said nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO: 1 thereto.

The present invention also includes antagonists to miR-1885b.3, pri-miR1885b.3, pre- miR1885b.3, or their coding gene. Since antagonists to miR-1885b.3, pri-miR1885b.3, pre- miR1885b.3, or the gene encoding miR-1885b.3, pri-miR1885b.3, pre-miR1885b.3

(hereinafter also referred to as "their coding gene") can regulate the activity or expression of the miR-1885b.3, pri-miR1885b.3, pre-miR1885b.3, or their coding gene, the said

antagonists can also enhance the heat tolerance of a plant through affecting the miR- 1885b.3, pri-miR1885b.3, pre-miR1885b.3, or their coding gene, such that traits are improved. The antagonists of miR-1885b.3, pri-miR1885b.3, pre-miR1885b.3, or their coding gene, refer to any substance that can reduce the activity of miR-1885b.3, pri-miR1885b.3, pre-miR1885b.3, or their coding gene, compromise the stability of miR-1885b.3, pri- miR1885b.3, pre-miR1885b.3, or their coding gene, suppress the expression of miR-1885b.3, pri-miR1885b.3, pre-miR1885b.3, or their coding gene, shorten effect duration of miR-

1885b.3, pri-miR1885b.3, pre-miR1885b.3, or their coding gene, or suppress transcription of miR-1885b.3, pri-miR1885b.3, pre-miR1885b.3, or their coding gene. These substances can be used in the present invention as agents for enhancing the heat tolerance of plants.

In an embodiment, a nucleotide sequence which is the complement of the nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to the complement of the nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2 is introduced into said plant to provide a plant with improved heat tolerance. Without being bound by theory, it is hypothesized that miR-1885b.3 is scavenged as to reduce levels of miR-1885b.3 available for binding to one or more of its targets (for example, QQ7^"i and/or FRA-8). As such, levels of unbound target are higher compared to unmodified plants resulting in improved tolerance in plants comprising such nucleotide sequence.

In an embodiment, the expression of the gene encoding a nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2 is downregulated, for example by replacing its native promoter with a weaker promoter or with a promoter that is only expressed upon non-heat stress conditions. Alternatively, its native promoter may be mutated in order to reduce or eliminate transcription. For example, one of the core promoter elements such as TATA box or Inr box may be mutated to prevent or reduce transcription of the gene encoding a nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2.

In another embodiment, the gene encoding a nucleotide sequence as shown in SEQ

ID NO:1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO: 1 or a precursor thereof as shown in SEQ ID NO:2 is mutated as to reduce or eliminate binding of SEQ ID NO:1 or said nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 to its mRNA target and/or to reduce or eliminate cleaving of the mRNA target after binding of SEQ ID NO:1 or said nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 thereto. For example, one or more nucleotides in SEQ ID NO:1 or said nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 may be mutated so as to reduce binding thereof to its target(s). Alternatively, one or more nucleotides in SEQ ID NO:2 may be mutated to prevent splicing thereof into the mature miRNA of SEQ ID NO: 1. Another option is mutation of one or more nucleotides in SEQ ID NO:1 or said nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 so as to reduce cleavage of target mRNA once the nucleotide sequence as shown in SEQ ID NO:1 or a variant thereof has bound.

The present invention also relates to a method for modifying a plant (in particular to improve the heat tolerance of the plant), comprising enhancing the expression of the QQT7 and/or FRA-8 gene and/or the activity of the encoded protein in the plant.

Methods for enhancing the expression of the QQ7^~7 and/or FRA-8 gene are well known in the art. For example, plants can be transformed with an expression construct carrying the QQ77 coding gene to over-express the QQ77 gene and/or with an expression construct carrying the FRA-8 coding gene to over-express the FRA-8 gene. A promoter can be used to enhance the expression of the QQ77 and/or FRA-8 gene. An enhancer (such as the first intron of the rice waxy gene or the first intron of the Actin gene, and the like) can be used to enhance the expression of the QQ77 and/or FRA-8 gene. Promoters include but are not limited to the 35S promoter, and the Ubi promoter in rice and corn.

In one embodiment of the present invention, a method for obtaining a plant with enhanced expression of QQT1 and/or FRA-8 protein includes:

(1 ) providing an Agrobacterium strain containing an expression vector, wherein the expression vector contains the DNA coding sequence of the QQT1 and/or FRA-8 protein;

(2) contacting a plant cell, tissue or organ with the Agrobacterium of step (1 ) such that the DNA coding sequence of the QQT1 and/or FRA-8 protein is transformed into the plant cell and integrated into the chromosome;

(3) selecting the plant cell or tissue transformed with the DNA coding sequence of the QQT1 and/or FRA-8 protein; and

(4) regenerating the plant cell or tissue of step (3) into a plant.

Any suitable conventional means, including reagents, temperature and pressure controls, can be used in this process.

The present invention also includes agonists to the QQT1 and/or FRA-8 protein or their coding genes. Since the agonists of the QQT1 and/or FRA-8 protein can regulate the activity or expression of the QQT1 and/or FRA-8 protein, the said agonists can also enhance the heat tolerance of a plant through affecting the QQT1 and/or FRA-8 protein, such that traits are improved. The agonists of the QQT1 and/or FRA-8 protein refer to any substance that can enhance the activity of QQT1 and/or FRA-8, maintain the stability of QQT1 and/or FRA-8, promote the expression of QQT1 and/or FRA-8, prolong effect duration of QQT1 and/or FRA- 8, or promote transcription and translation of QQT1 and/or FRA-8. These substances can be used in the present invention as agents for enhancing the heat tolerance of plants.

In an embodiment of the present invention, a QQT1 and/or FRA-8 gene is provided, the coding sequence of which is listed in SEQ ID NOs:3 and 4, respectively. The QQT7 gene encodes a protein containing 314 amino acids and the FRA-8 gene encodes a protein containing 458 amino acids (SEQ ID NOs:5 and 6, respectively). Said QQT1 and/or FRA-8 genes provide a new route for modification of tolerance, particularly heat tolerance, of a plant.

Thus, the present invention also relates to a method for producing a plant and/or a part thereof with improved heat tolerance, said method comprising the step of increasing the level of mRNA corresponding to the nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, and/or of mRNA corresponding to a nucleic acid sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5; and/or decreasing the binding capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, and/or of mRNA corresponding to a nucleic acid sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, to miR-1885b.3; and/or decreasing the capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, and/or of mRNA corresponding to a nucleic acid sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, to be cleaved by miR-1885b.3 in said plant.

The step of increasing the level of mRNA corresponding to the nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, and/or of mRNA corresponding to a nucleotide sequence encoding a protein having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5; and/or decreasing the binding capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, and/or of mRNA corresponding to a nucleic acid sequence encoding a protein having the amino acid sequence of SEQ ID NO:5 or a protein which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, to miR-1885b.3; and/or decreasing the capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, and/or of mRNA corresponding to a nucleic acid sequence encoding a protein having the amino acid sequence of SEQ ID NO:5 or a protein which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, to be cleaved by miR-1885b.3, in said plant may comprise one or more steps selected from the group consisting of:

- overexpressing the nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3 in said plant, or a nucleic acid sequence encoding the protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5; and

- mutating a gene encoding an mRNA corresponding to the nucleotide sequence as shown in SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, and/or of a nucleic acid sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, as to reduce or eliminate binding of SEQ ID NO:1 or a nucleotide sequence having at least 80% identity with SEQ ID NO:1 , to mRNA corresponding to SEQ ID NO:3 or said nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, and/or to mRNA corresponding to a nucleic acid sequence encoding a protein having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5; and/or to reduce or eliminate cleaving of mRNA corresponding to SEQ ID NO:3 or said nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, and/or of mRNA corresponding to a nucleic acid sequence encoding a protein having the amino acid sequence of SEQ ID NO:5 or a protein which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, after binding of SEQ ID NO:1 or a nucleotide sequence having at least 80% identity with SEQ ID NO:1 thereto.

In an embodiment, the nucleic acid sequence referred to above has an identity of at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, to the nucleic acid sequence of SEQ ID NO:3.

The invention also relates to a method for producing a plant and/or a part thereof with improved heat tolerance, said method comprising the step of increasing the level of mRNA corresponding to the nucleic acid sequence having SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, and/or of mRNA corresponding to a nucleic acid sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:6 or protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, in said plant.

In an embodiment, the nucleic acid sequence referred to above has an identity of at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, to the nucleic acid sequence of SEQ ID NO:4.

Also provided are "variants" of the above QQT1 proteins and FRA-8 proteins. These variants include nucleic acid sequences essentially similar to SEQ ID NO: 5 and SEQ ID NO: 6, and which are capable being targeted by miR-1885b.3. Sequences which are "essentially similar" to SEQ ID NO: 5 and 6, respectively, are amino acid sequences comprising at least about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99% or more amino acid sequence identity to SEQ ID NO:5 or to SEQ ID NO:6, respectively. Preferably, said identity is determined over the full length of the amino acid sequence. Such variants may also be used in the methods of the present invention.

The step of increasing the level of mRNA corresponding to a nucleic acid sequence having SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, and/or of mRNA corresponding to a nucleic acid sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:6 or protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, in said plant may comprise one or more steps selected from the group consisting of:

- overexpressing the nucleic acid sequence having SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, or a nucleic acid sequence encoding the protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, in said plant; and

- mutating a gene encoding an mRNA corresponding to the nucleotide sequence as shown in SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, and/or of a nucleic acid sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:6 or protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, as to reduce or eliminate binding of SEQ ID NO:1 or a nucleotide sequence having at least 80% identity with SEQ ID NO:1 to mRNA corresponding to SEQ ID NO:4 or said nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, and/or of mRNA corresponding to a nucleic acid sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:6 or protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6; and/or to reduce or eliminate cleaving of mRNA corresponding to SEQ ID NO:4 or said nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, and/or of mRNA corresponding to a nucleic acid sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:6 or protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, after binding of SEQ ID NO:1 or a nucleotide sequence having at least 80% identity with SEQ ID NO: 1 thereto.

Non-transgenic methods and plants

The invention also relates to plants, preferably plants belonging to the family

Brassicaceae, more preferably to the genus Brassica even more preferably to the species Brassica rapus, in which about one up to about 2, 3, 4, or 5 nucleotides of SEQ ID NO:1 , 2, 3 and/or 4 or variants thereof, such as naturally occurring variants, have been mutated in order to: i) reduce or eliminate binding between miR-1885b.3 and its target(s) QQT1 and/or FRA-8 mRNA; ii) reduce or eliminate cleavage of target (QQT1 and/or FRA-8) mRNA after binding between miR-1885b.3 and its target(s) QQT1 and/or FRA-8 mRNA; iii) reduce or eliminate cleavage of pri-miR-1885b.3 into pre-miR-1885b.3 and/or of pre-miR-1885b.3 into mature miR-1885b.3; iv) reduce or eliminate transcription of the gene encoding pri-miR-1885b.3, for example by mutating the promoter sequence; v) overexpress QQT1 and/or FRA-8, for example by mutating the promoter sequence.

Naturally occurring variants may be identified using routine methods in the art.

Primers can be designed based on any one of SEQ ID NOs: 1 -4 to identify naturally occurring variants in other plant families/genera/species.

Those naturally occurring variants may be aligned to any one of SEQ ID NOs: 1 -4 to identify allelic variation between naturally occurring variants of these nucleic acids. Such allelic variations may be used to produce non-transgenic plants having improved heat tolerance.

The plants may be used in conventional agricultural and breeding methods. In particular, they may be grown in environments which subject the plants to one or more biotic and/or abiotic stress conditions, in e.g areas with high or low temperature.

Alternatively, non-transgenic plants or plant cells comprising either non-functional alleles of the gene encoding miR-1885b.3 or increased expression of endogenous QQ7^"i and/or FRA-8 genes may be identified. It is also an embodiment of the invention to use non- transgenic methods, e.g. mutagenesis systems such as TILLING (Targeting Induced Local Lesions IN Genomics; McCallum et al., 2000, Nat Biotech 18:455, and McCallum et al. 2000, Plant Physiol. 123, 439-442, both incorporated herein by reference) and selection to generate plant lines in which about one up to about 2, 3, 4, or 5 nucleotides of SEQ ID NO:1 , 2, 3 and/or 4 or variants thereof, such as naturally occurring variants, have been mutated in order to: i) reduce or eliminate binding between miR-1885b.3 and its target(s) QQT1 and/or FRA-8 mRNA; ii) reduce or eliminate cleavage of target (QQT1 and/or FRA-8) imRNA after binding between miR-1885b.3 and its target(s) QQT1 and/or FRA-8 mRNA; iii) reduce or eliminate cleavage of pri-miR-1885b.3 into pre-miR-1885b.3 and/or of pre-miR-1885b.3 into mature miR-1885b.3; iv) reduce or eliminate transcription of the gene encoding pri-miR-1885b.3, for example by mutating the promoter sequence; v) overexpress QQT1 and/or FRA-8, for example by mutating the promoter sequence. Without limiting the scope of the invention, it is believed that such plants could comprise point/deletion mutations in the genes or in the promoters. Mutations in the promoter in regions that are binding sites for repressor proteins would make the host gene constitutive or higher in expression. TILLING uses traditional chemical mutagenesis (e.g. EMS mutagenesis) followed by high-throughput screening for mutations (e.g. using Cel 1 cleavage of mutant-wildtype DNA heteroduplexes and detection using a sequencing gel system), see e.g. Henikoff et al. Plant Physiology Preview May 21 , 2004. Thus, non-transgenic plants, seeds and tissues are encompassed herein.

The method comprises in one embodiment the steps of mutagenising plant seeds

(e.g. EMS mutagenesis), pooling of plant individuals or DNA, PCR amplification of a region of interest, heteroduplex formation and high-throughput detection, identification of the mutant plant, sequencing of the mutant PCR product. It is understood that other mutagenesis and selection methods may equally be used to generate such mutant plants. Seeds may for example be radiated or chemically treated and the plants screened for a modified recombination frequency.

In another embodiment of the invention, the plant materials are natural populations of the species or related species that comprise polymorphisms or variations in DNA sequence at the QQT1 , FRA-8, or miR1885b.3 orthologous coding and/or regulatory sequences. Mutations in the QQT1 , FRA-8, or miR1885b.3 gene targets can be screened for using a ECOTILLING approach (Henikoff et al 2004, supra). In this method natural polymorphisms in breeding lines or related species are screened for by the above described TILLING methodology, in which individual or pools of plants are used for PCR amplification of the QQT1 , FRA-8, or miR1885b.3 targets, heteroduplex formation and high-throughput analysis. This can be followed up by selecting of individual plants having the required mutation that can be used subsequently in a breeding program to incorporate the desired allele to develop the cultivar with desired trait.

In a further embodiment non-transgenic mutant plants which produce lower levels of miR-1885b.3 in one or more tissues are provided, or which completely lack miR-1885b.3 in specific tissues or which produce a non-functional miR-1885b.3 in certain tissues, e.g. due to mutations in one or more endogenous alleles of the gene encoding miR-1885b.3. For this purpose also methods such as TILLING may be used. Seeds may be mutagenized using e.g. radiation or chemical mutagenesis and mutants may be identified by detection of DNA polymorphisms using for example CEL 1 cleavage. Especially, mutants which comprise mutations in one or more alleles of the gene encoding miR-1885b.3 are provided. Nonfunctional alleles of the gene encoding miR-1885b.3 may be isolated and sequenced or may be transferred to other plants by breeding methods.

Mutant plants can be distinguished from non-mutants by molecular methods, such as the mutation(s) present in the DNA, protein levels, RNA levels etc, and by the modified phenotypic characteristics.

The non-transgenic mutants may be homozygous or heterozygous for the mutation or for the mutant allele(s).

Sequence Listing

The present invention recites the following sequences:

SEQ ID NO:1 : mature miR-1885b.3 sequence

SEQ ID NO:2: pre-miR-1885b.3 sequence

SEQ ID NO:3: Coding sequence of QQT1 from Brassica rapa

SEQ ID NO:4: Coding sequence of FRA-8 from Brassica rapa

SEQ ID NO:5: Protein sequence of QQT1 from Brassica rapa

SEQ ID NO:6: Protein sequence of FRA-8 from Brassica rapa

SEQ ID NOs:7-12: Primers used in PCR (Table 1 ).

SEQ ID NOs: 13-31 miRNAs in Chinese cabbage (see table 5)

SEQ ID NOs:32-43 Primers used for miR1885b.3/QQT1 constructs (see table 7)

SEQ ID NO: 44: sequence of IPS1 ; when constructing p35S:MIMbra-1885b.3 , nucleotides

236-259 in the IPS1 sequence were replaced by

ACTTCCTTCTTCTATGTCCACAAT(MIM1885b.3)

SEQ ID NO: 45: sequence of pRS300; when constructing p35S:amiR1885b.3 , nucleotides

803-822 in pRS300 were replaced by ATTGTGGACAAAGAAGGAAG (correspond to miR1885*) (miR398*), and nucleotides 953-972 were replaced by

CTCCCTTCTTTGTGCACAAT (correspond to miR1885)

SEQ ID NO:46 a CSD1 target sequence from Brassica rapa

SEQ ID NO:47 a QQT1 target sequence from Brassica rapa

Examples Example 1. Identification of miRNAs that are responsive to heat stress in Brassica rapa Materials and Methods

Small RNA deep sequencing

Wu-1 1 , an inbred line belonging to non-heading Chinese cabbage (β. rapa ssp. chinensis), was used for constructing small RNA libraries. All plants were grown under a 16h-light/8h- dark photoperiod at 22°C for three weeks; and some of the samples were treated with heat shock at 46°C for 1 hour. RNA samples from aboveground parts of the seedlings were prepared using the Alternative v1.5 Protocol (lllumina, 2009), and small RNA sequencing was performed using an lllumina GAM sequencer and a mirVana™ miRNA Isolation Kit (Ambion, Inc).

Analysis of conserved miRNAs

Our small RNA deep-sequencing data were aligned with mature sequences of Arabidopsis miRNA families in the miRbase allowing for fewer than 4 mismatches. Then all potential miRNAs were matched with the Brassica genomic scaffold sequence (http://brassicadb.org) or expressed sequence tag (EST) databases from the Brassica Genome Gateway

(http://brassica.bbsrc.ac.uk/) for exporting the 600-bp flanking sequences from their genomic loci or whole EST sequences, both of which were used to predict secondary structures by RNAfold software. Finally, it was identified whether these precursors satisfied the standard of miRNA stem-loop (Meyers et al., 2008. Plant Cell, 20:3186-3190).

Identification of novel miRNAs in B. rapa

All of the small RNAs we obtained from small RNA deep sequencing were blasted with the Brassica genomic Scaffold database and Brassica expressed sequence tags (EST). Small RNAs that had fewer than 10 hits in the genome were retained. From these databases, 600- bp flanking sequences of small RNAs were used to predict their secondary structures by RNAfold software. Accordingly, a judgment was made by determining whether the small RNAs and their reverse were on the stem with fewer than 4 mismatches (more than 3 continuous mismatches were also not allowed) as the standard of miRNA stem-loop described in the literature (Meyers et al., 2008, supra). To investigate the origins of the proper precursors of the stem-loop, the small RNAs were aligned with the Arabidopsis cDNA database of TAIR 9 by local BLASTN. Finally, all siRNAs in our small RNA database were aligned with the precursors and the map of siRNA distribution in the precursors was displayed. Precursors that were homologous to ribosomal RNA and transposable element genes (TE) were mostly excluded. Novel miRNAs were selected according to the criteria of both miRNA, miRNA* existence and small RNA distribution in the precursors. Target prediction of novel miRNAs

Complementary sequences of EST were searched with fewer than four differences with novel miRNA in the Brassica EST database. Matches were given a ranking score, with

complementary base pairing assigned 1 point, G-U bonds between the miRNA and target assigned 0.5 point, mismatches assigned -1 point, and mismatches at position 10 or 1 1 assigned with -2 points. Matches were dismissed if they contained consecutive mismatches, more than two mismatches in the first 10 bases, or more than three mismatches in the remaining bases. Finally, the EST sequences of potential targets were aligned with the Arabidopsis cDNA database of TAIR 9 to identify ESTs which are homologous with

Arabidopsis genes as targets.

Northern blotting

30 -50 pg of RNA was separated on 19% polyacrylamide denaturing gels. RNAs were electrophoretically transferred to Hybond membrane (Amersham biosciences-GE healthcare) for 2 hours at 200 mA; After cross-linking by 3 min of UV irradiation, the Hybond membrane was hybridized with the biotin-marked DNA probes complementary to predicted miRNA sequences at 42°C overnight, And the Hybond membrane was washed at 42°C twice with 2xSSC, 0.1 % SDS, followed by two higher stringency washes of 0.1 xSSC,0.1 % SDS at 42°C. Next, the membrane was incubated with stabilized streptavidin-HRP conjugate

(Thermo) in nucleic acid detection blocking buffer, and then washed 5 times with 1 xwash buffer. At last, after washing with substrate equilibration buffer and adding with stable peroxide solution and enhancer solution, blots were imaged using an FLA-5000 Phosphor- Imager (Fujifilm). Blots were also probed with a DNA probe complementary to U6 to confirm uniform loading. The sequences of DNA probes for small RNA Northern blotting were synthesized with biotin modification by Invitrogen Company using a 3'-end DNA labeling method.

5'- RACE PCR

The 5' Full Race PCR kit (Takara) was used without the step of CIAP (Alkaline Phosphatase) and TAP (Tobacco Acid Pyrophosphatase) treatment. RNA was ligated directly to the 5' adaptor to detect the cleavage sites of the miRNA-targeted genes. In addition, oligo-dT primers were used for reverse transcription rather than random primers. Two gene-specific primers were used for each RACE (Table 1 ). The PCR products from a positive 5' RACE reaction were gel purified and cloned (PMD18T vector, Takara) for sequencing.

Real-time PCR and RT-PCR Total RNA was extracted with TRIzol (Invitrogen) and treated with DNase I (Takara) to remove DNA contamination. Approximately 4μg of RNA was used for reverse transcription with oligo dT primers. Real time PCR and RT-PCR were performed using specific pairs of primers (Table 1 ). The comparative threshold cycle (Ct) method was used to determine relative transcript levels in real-time PCR (MyiQ2, two colours Real-time PCR Detection System, Bio-Rad), while the relative transcript levels were determined by running gel following RT-PCR. BrcACT4 of Brassica rapa that is homologous to Arabidopsis ACT4 encoding actin was used as an internal control. Three biological replicates and three technological replicates were performed.

Table 1. Primers used in 5'-RACE-PCR and real-time PCR.

Primers Sequences experiment SEQ ID

Brac-CSD1 -54S CCCTGAGATCACAAAGGATATACAA Real-time PCR 7

Brac-CSD1 - 8

TGAAGAAGATAGTCCCCTTAACACC Real-time PCR

143A

□Y029374-41 S AACTTCTCCACCTTTCACCATTC RT-PCR 9

□Y029374-561A GTTGCTGCATCTCTCGTTGG RT-PCR 10

EE423375-157S TTACCGTATGAGTGTGCTGTGA RT-PCR 1 1

EE423375-633A GTAGTTCTGCAAGTATGACAAGTC RT-PCR 12

Results

Genome-wide analysis of small RNAs responsive to heat stress

High temperature inhibits plant growth and causes leaf etiolation and even death. Severity of leaf etiolation is correlated with the level and duration of the high temperature treatment. To define temperature thresholds such as base temperature and thermal time requirement in changing environments during seedling growth, the seedlings of non-heading Chinese cabbage were incubated at 44, 45, 46, 47 and 48°C for durations of 0.5, 1 and 2 hours, respectively. We found that the temperature threshold for the genotype Wu-1 1 would be 46°C for 1 h since the plants with this treatment stopped growing when transplanted to normal temperature, and were etiolated 12 days after the heat treatment. We expected that this kind of heat treatment affected biogenesis of early-responsive small RNAs but would have less secondary consequences of morphological and physiological changes. To examine heat-responsive small RNAs, we performed heat treatment on the three-week-old seedlings of non-heading Chinese cabbage in two separate experiments. In the first experiment, the seedlings were exposed to 46°C (high temperature, HT1 ) and 22°C (normal temperature, NT1 ), respectively, for 1 hour. After heat treatment, the above-ground parts of the seedlings were harvested immediately. The small RNA fraction ranging from 9 to 36 nucleotides (nt) in size was isolated from the plant samples. The small RNA libraries constructed from HT and NT treatments were designated as HT1 and NT1 libraries. To confirm the quality of HT1 and NT1 libraries, we performed the second experiment to construct the sister small RNA libraries (HT2 and NT2) using the same methods as in the first experiment.

NT1 and HT1 treatments generated 14.67 million and 12.77 million small RNA reads in the first experiment; and NT2 and HT2 treatments generated 1 1 .25 million and 14.61 million small RNA reads in the second experiment (Table 2). Because of the difference in

abundance of total small RNAs between NT and HT datasets in each experiment, we normalized the abundance of each dataset to 10 million [units of transcripts per 10 million (TP10M)].

Some small RNAs were presented in the HT datasets rather than in the NT datasets and hence designated as HT1 - and HT2-specific, while others were presented in the NT datasets rather than in the HT datasets and regarded as NT1 - or NT2-specific. HT-specific small RNAs (28% and 29% for HT1 and HT2) were more than NT-specific ones (22% and 24% for NT1 and NT2), meaning that heat stress induces some small RNAs whereas it represses other small RNAs and that induction of unique small RNAs is more dominant than repression. Nevertheless, the majority of small RNAs were shared between HT and NT datasets as they were in common for two populations.

Small RNA sequences of Chinese cabbage {B.rapa) exhibited a wide variance in length, from 9 to 36 nt (Fig. 1 ). Among them, small RNAs of 24-nt were the most numerous. Total reads of 24-nt small RNAs in each HT dataset are increased compared to those of NT dataset, suggesting that 24-nt small RNAs are predominant in B. rapa and that biogenesis of them are sensitive to heat stress. The small RNAs of 21 -nt were fewer than those of 24-nt but more than those of the other observed lengths. Under heat stress, total reads of 21 -nt small RNAs that are mainly composed of miRNAs were more than those in NT treatment, indicating that abundance of miRNAs under heat stress are greater than those at normal temperature.

Length distribution of unique small RNAs was consistent with that of total reads.

Identification of conserved miRNAs that are responsive to heat stress

In B. rapa, 19 miRNAs belonging to 10 miRNA families have been separately reported in three previous studies. Of these, 18 were identical to miRNAs of Arabidopsis. All of these miRNAs, including one miRNA known only in B. rapa, were present in the NT and HT treatment datasets.

To select the conserved miRNAs from the entire population of our datasets, small RNAs were aligned with the known miRNAs in the miRBase allowing for 1 or 2 mismatches. Then the satisfied small RNAs were matched with DNA sequences of the Brassica scaffold database and expressed sequence tags (EST). In total, 62 small RNAs were identical (perfect match) or similar (1 or 2 mismatches) to the 35 known miRNA families of Arabidopsis and were therefore designated as conserved miRNAs. The 158 nt flanking sequences of these miRNA families were defined as miRNA precursors according to the miRNA/miRNA* standard (Table 3). We aligned all of these Brassica miRNA precursors with the Arabidopsis miRNA precursors using local BLASTN. There were two or three homologous copies in Brassica genome that corresponded to each Arabidopsis MIRNA genes. These findings are consistent with the report that the diploid Chinese cabbage has characteristics of whole genome triplication compared to Arabidopsis. We named the conserved miRNA genes of B. rapa according to their homologous Arabidopsis genes. Among these 158 miRNA genes of Chinese cabbage, 136 identified identical miRNA sequences in Arabidopsis, and 22 had similar miRNA sequences (Table 3).

We investigated how many miRNAs among these 35 miRNA families of β. rapa were conserved beyond the Brassicaceae family. In miRBase, 38 miRNA families in Arabidopsis have homologues in species beyond the Brassicaceae family. Among these, miR413 through miR420 and miR426 have been questioned. None of these questioned miRNAs were found in our small RNA database or matched with genomic sequences of Brassica genome database. On the contrary, miR783 is conserved between A. thaliana and Pinus taeda, but was not found in A. lyrata or B. rapa. Therefore there were at least 28 miRNA families in B. rapa that are highly conserved between Brassicaceae and species outside the Brassicaceae, while the other 7 miRNA families of B. rapa are likely to be Brass/^'caceae-specific (Table 3). miR173 is involved in the biogenesis of ta-siRNAs by processing the precursors of TAS1 and TAS2. Surprisingly, we did not find miR173 and miR173-drived ta-siRNA sequences or their homologues in all of the four small RNA datasets. To examine whether there are any homologous genes of miR173 in Chinese cabbage, we searched the Brassica GSS database. No genomic sequences of Chinese cabbage were homologous to miR173, TAS1 and TAS2 genes in Arabidopsis. Probably, therefore, the genome of Chinese cabbage lacks the miR173, TAS1 and TAS2 genes. In contrast, miR390 and the corresponding ta-siRNA sequences were present in our small RNAs dataset and were matched to the Brassica scaffold database, indicating that the miR390 and TAS3 genes in Chinese cabbage are functional. In addition, the bra-miR828 that targets at TAS4 was detected in Chinese cabbage but siRNA generated from TAS4 was not found. We deduce that the ta-siRNAs from TAS1 , TAS2 and TAS4 genes may not exist in Chinese cabbage. Nevertheless, neither miR390 nor ta-siRNAs from TAS3 were affected by high temperature.

After annotating the conserved miRNAs, we were able to examine which miRNAs are responsive to heat stress. The 35 conserved miRNA families in Chinese cabbage include 62 sequence-specific miRNAs. Among heat-responsive miRNAs, 1 was up-regulated while 4 down-regulated with more than a 2-fold change (Table 4). Remarkably, bra-miR398a was down-regulated with more than a 10-fold change. Its homologue in Arabidopsis has been well-known to response to oxidative stress by regulating its target CSD1 , a Cu/Zn superoxide dismutase (Sunkar et al., 2006. Plant Cell, 18:2051 -2065). To confirm the heat response of bra-miR398a, we performed Northern blotting of the miRNA and real-time PCR of the target gene. The accumulation of bra-miR398a in the HT seedlings was much lower than in the NT seedlings (Fig. 2A, 2B). On the contrary, the expression of BracCSDI , as a target gene of bra-miR398a, was much higher in the HT seedlings than in the NT seedlings (Fig. 2C). This result indicates that BracCSDI regulates heat response of B. rapa and that bra-miR398a guides BracCSDI gene by silencing it.

Analysis of heat-responsive small RNAs originating from miRNA precursors

Many small RNAs are generated from the miRNA precursors in Arabidopsis. Some of them, called miRNA-sibling RNAs, also play a post-transcriptional role by cleaving target genes. According to the distribution of small RNAs in miRNA precursors, small RNAs are classified into three types: miRNA variants overlapped with miRNA, miRNA* variants overlapped with miRNA*, and miRNA-sibling RNAs in the flanking sequences of imiRNAs or miRNA*.

Consistent with the heat-responsive miRNA, some small siRNAs from the same precursor display the same pattern of heat response. For example, both the miRNA variants and miRNA* variants of bra-miR156h-2 were up-regulated under heat stress (Fig. 3A,). However, the heat-responses of a few miRNA* variants is different from that of their own miRNA variants.

The accumulation of the miRNA* variants of bra-miR167a and bra-miR400 were repressed by heat stress whereas that of their miRNA variants were slightly up-regulated or unchanged (Fig. 3B, C). These results suggest that high temperature affect processing or stability of miRNAs and/or their miRNA* variants in different ways.

Identification of novel miRNAs responsive to heat stress

To predict novel miRNAs in Brassica, we matched all of the small RNAs (20-22 bp) of Chinese cabbage with the Brassica scaffold database and expressed sequence tags (EST). The 600-bp flanking fragments of small RNAs were used to draw their secondary structure using RNAfold. Candidate precursors were selected according to whether the small RNAs and their reverse sequences were on the stem, with fewer than 4 bugles, according to one of the miRNA standards (Meyers et al., 2008, supra). Then, we aligned the candidate precursors with the Arabidopsis cDNA database using local BLASTN. Lastly, all small RNAs in our database were matched to the candidate precursors and distribution of small RNA was mapped along the candidate precursors. We excluded the precursors homologous to ribosomal RNA, most transposable element genes (TE), and those with many smear sequences. According to the miRNA/miRNA* criteria, 21 novel miRNAs belonging to 19 miRNA families were selected (Table 5). Potential targets of all of the novel miRNA were predicted according to the complementarity between miRNAs and EST sequences.

Among the novel miRNAs, miR5 and miR19 were up-regulated and miR7 and miR1885b.3 were down-regulated with more than a 2-fold change under heat stress (Table 4).

miR1885b.3 precursors were able to produce 3 pairs of miRNA/miRNA* (Fig. 4A). Under heat stress, the accumulations of miR1885b.3, miR1885b.3* and miR9.2* were repressed severely (Fig. 4B). To confirm the heat response of these novel miRNAs, we performed Northern blotting of small RNA. The accumulation of miR1885b.3 in HT seedlings was reduced sharply by heat stress. In contrast, two of the putative target genes were up- regulated under the same condition (Fig. 4 C-E).

Another heat-responsive novel miRNA is bra-miR10 (Fig. 5A, B). Under heat stress, the accumulation of bra-miR10 was increased with more than 1 .5-fold change, while most of the small RNAs originated from the bra-miR10 precursor were also heat-induced. In contrast, BracPAPI O, the putative target gene of bra-miR10, was remarkably down-regulated (Fig. 5C). Our results reveal that bra-miR1885b.3 and bra-miR10 are two of novel miRNAs that function in heat response of B. rapa.

Evolutionary relationship between novel miRNAs and their targets

By comparing the sequence similarity of the putative miRNA precursors against the

Arabidopsis cDNA database by BLASTN, we found that the putative precursors of 10 novel miRNAs were homologous to certain fragments of the protein-coding genes. Among these novel miRNAs, three cleaved their targets, from which they may have evolved. The precursor of bra-miR4 may evolve from the gene BracDRLI (DEFORMED ROOTS AND LEAVES 1 ) (Fig. 6A). As indicated in Fig. 6B, bra-miR4-3p and bra-miR4-5p are two small RNAs that are derived from the same precursor. The low-abundant bra-miR4-3p was predicted to target BracDRLI while the high-abundant bra-miR4-5p was predicted to target BracVELI . To define the cleavage sites of these miRNA-targeted genes, we performed 5'-RACE experiments. As expected, the transcripts of BracDRLI and BracVELI were cleaved in the regions

complimentary with bra-miR4-3p and bra-miR4-5p, respectively. Similarly, bra-miR9.1 and bra-miR1885b.3 are two small RNAs from the same precursor. They may have evolved from the gene BracTAOI (Fig. 6C). 5'-RACE experiments showed that bra-miR9.1 rather than bra- miR1885b.3 cleaves BracTAOI (Fig. 6D). We suggest that miRNAs derived from the same miRNA precursors regulate different targets at the post-transcriptional level. The third miRNA that may evolve from its target was bra-miR10 (Fig. 5A). Our 5'-RACE PCR confirmed that the transcripts of bracPAPI O were cleaved by bra-miR10 (Fig. 5B). Some novel miRNAs without similarity to the genes are thought to have acquired their features through random mutation of the original region, and a few plant miRNA genes in plant are known to be derived from TEs (transposable elements). We noticed that bra-miR3 is a unique TE-like precursor. In Chinese cabbage seedlings, both bra-miR3 and bra-miR3* were detected, while no bra-miR3-sibling RNA was found, revealing that the DCL1/HYL1 complex recognizes this hairpin structure. miRNA precursors such as bra-miR3 may have evolved from TE sequences.

Table 2. Number of total reads in the small RNA databases of Chinese cabbage. NT1 and HT1 are two types of small RNA datasets derived from NT and HT treatments in experiment 1 ; and NT2 and HT2 are two types of small RNA libraries derived from NT and HT treatments in experiment 2. Specific small RNAs are detected in one type of datasets rather than in another. Shared small RNAs are present in both types of datasets.

Experiment 1

Small RNA datasets Total reads %

NT1 Whole 14,665,848 100

Specific 3,174,419 22

Shared with HT 1 1 ,491 ,429 78

HT1 Whole 12,767,792 100

Specific 3,638,641 28

Shared with NT 9,129,151 72

Experiment 2

Small RNA datasets Total reads

NT2 Whole 1 1 ,250,443 100

Specific 2,653,762 24

Shared with HT 8,596,681 76

HT2 Whole 14,607,504 100

Specific 4,196,326 29

Shared with NT 10,41 1 ,178 71 Table 3. Number of the miRNAs conserved between Chinese cabbage and Arabidopsis. Identical members (IM) represent the sequences of Chinese cabbage bra-miRNA identical to Arabidopsis ath-miRNA; and similar members (SM) represent the sequences of bra- miRNA similar to ath-miRNA with 1 -2 mismatches. (H) represents the miRNA families that are highly conserved between the Brassicaceae family and other species beyond the Brassicaceae family. (L) represents the Srass/^'caceae-specific miRNA families.

miRNA families Number of IM Number of SM Total bra-miR156 (H) 1 17

bra-miR157 (H) 0 4 bra-miR158 (L) 1 1 2

bra-miR159 (H) 4 0 4

bra-miR160 (H) 6 1 7

bra-miR161 (L) 0 1 1

bra-miR162 (H) 2 0 2

bra-miR164 (H) 6 0 6

bra-miR165 (L) 2 0 2

bra-miR166 (H) 6 0 6

bra-miR167 (H) 3 2 5

bra-miR168 (H) 3 2 5

bra-miR169 (H) 13 3 16

bra-miR171 (H) 2 3 5

bra-miR172 (H) 1 1 0 1 1

bra-miR319 (H) 6 1 7

bra-miR390 (H) 6 0 6

bra-miR391 (L) 3 0 3

bra-miR393 (H) 4 0 4

bra-miR394 (H) 5 0 5

bra-miR395 (H) 9 1 10

bra-miR396 (H) 2 0 2

bra-miR397 (H) 1 0 1

bra-miR398 (H) 4 0 4

bra-miR399 (H) 5 2 7

bra-miR400 (L) 1 0 1

bra-miR403 (H) 1 0 1

bra-miR408 (H) 1 0 1

bra-miR472 (H) 0 1 1

bra-miR824 (L) 3 0 3

bra-miR827 (H) 0 1 1

bra-miR828 (H) 2 1 3

bra-miR838 (L) 0 1 1

bra-miR845 (H) 1 0 1

bra-miR21 1 1 (H) 3 0 3

Total 136 22 158

Table 4. Reads of the miRNAs that are down-regulated or up-regulated with more than 2- fold change under HT treatment. NT1 and HT1 are two types of small RNA datasets derived from NT and HT treatments in experiment 1 ; and NT2 and HT2 are two types of small RNA datasets derived from NT and HT treatments in experiment 2.

Experiment 1 Experiment 2

miRNA NT1 HT1 HT1/NT1 NT2 HT2 HT2/NT2

bra-MIR156h 15 68 4.53 1 1 57 5.18 bra-MIR398a 894 70 0.08 933 62 0.07 bra-MIR398b 1297 336 0.26 1031 352 0.34 bra-MIR399b 35 17 0.49 31 10 0.32

bra-MIR827 5 2 0.40 4 2 0.50

bra-MIR5 30 103 3.43 36 104 2.89

bra-MIR7 87 27 0.31 89 17 0.19 bra-MIR1885b.3 3229 140 0.04 2872 202 0.07 bra-MIR19 7 27 3.86 4 25 6.25

Table 5. The sequences of novel miRNAs in Chinese cabbage

Novel imiRNA Mature miRNA sequences Length Number SEQ

families of loci ID

bra-MIR1 TGTTTTGTGGGTTTCTACCGA 22 1 13

bra-MIR2 ATAAATCCCAAGCATCATCCA 21 2 14

bra-MIR3 AATATTAATATAATTGGTGAG 21 1 15

bra-MIR4-5p AGGCTTAGAAGAACGTTTGTT 21 1 16

bra-MIR5 AGACTCTACGACATCAAGAAAC 22 1 17

bra-MIR6 ACGTGATAAGCCTCTGAAGAA 21 1 18

bra-MIR7 TTG G ATAATTG AAG ATATAAA 21 1 19

bra-MIR8 GTTTGGATTGTTTGCCTTGGC 21 1 20

bra-MIR9.2 TACATCTTCTCCGCGGAAGCTC 22 21

bra-MIR10 TCAGAACCAAACACAGAACAAG 22 1 22

bra-MIR1 1 TTGTGATGATAATACGACTTC 21 1 23

bra-MIR12 TTGTGATTTGGTTGGAATATC 21 1 24

bra-MIR13 AAAAATGGAGTGAGAAATGGA 21 1 25

bra-MIR1 TGAAATAGAGTCATGTGGAACG 22 1 26

bra-MIR15 ACAGCCTAAACCAATCGGAGC 21 1 27

bra-MIR16 AATGTGCTGCAATATCTCTGC 21 1 28

bra-MIR17 AACCGCCGGTTTGATAATAGC 21 1 29

bra-MIR18 ATTTG G C AC AATCTG ATCTG C 21 1 30

bra-MIR19 CAAAGGTTGCTTGAATAAGGT 21 31

Example 2. Heat tolerance identification of miRNA1885b.3 and its target BracQQTI that are responsive to heat stress in Brassica rapa

Methods and Materials

Constructs of p35S:BracQQT1.

p35S:BracQQT1 construct was obtained by PCR using KOD-plus polymerase (ToYoBo) with oligonucleotide pairs (BracQQTI -1 S and BracQQTI -921 A) as defined in the Table 6 and 7 (primers for constructs) and the cDNA of Brasscia.rapa as template. PCR product was added deoxyadenylic acid by rTaq (Takara), and linked to PMD18T vector, and then were digested with Kpnl and Xbal and cloned in the Kpnl and Xbal sites of pCAMBIA2301. Constructs of p35S:amiR1885b.3:

The artificial microRNA designer WMD delivers 4 oligonucleotide sequences (I to IV, table 6 and 7), which were used to engineer artificial microRNAs into the endogenous miR319a precursor by site-directed mutagenesis. Plasmid pRS300 was used as a template for the PCRs, which contains the miR319a precursor in pBSK.

Table 6

The amiRNA containing precursor is generated by overlapping PCR. A first round amplifies fragments (a) to (c), which are listed in the table above. These are subsequently fused in PCR (d).

For construct of p35S:amiR1885b.3, a first round amplifies fragments (a) to (c) were obtained by PCR using KOD-plus polymerase (ToYoBo) with the oligonucleotide pairs (amiRNA-A/ bra-amiR1885b.3-IV*a, bra-amiR1885b.3-lla/ bra-amiR1885b.3-lll*s, and bra-amiR1885b.3- Is/amiRNA-A) respectively, as defined in the Table (primers for constructs), and the pRS300 as template. The second round amplifies were obtained by overlapping PCR using KOD-plus polymerase (ToYoBo) with the oligonucleotide pairs (amiRNA-A/amiRNA-B) and products of (a) to (c) as template. The products were digested with Kpnl and Xbal and directly cloned in the Kpnl and Xbal sites of pCAMBIA2301 .

Constructs of p35S:MIMbra-1885b.3.

For construct of p35S:MIMbra-1885b.3, a first round amplifies (a) to (b) were obtained by PCR using KOD-plus polymerase (ToYoBo) with the oligonucleotide pairs (IPS1 -1 S-BamH1/ MIRbra-1885b.3-la, MIRbra-1885b.3-lls/IPS1 -522A-Sal1 ) respectively, as defined in the Table (primers for constructs), and the IPS1 as template. The second round amplifies were obtained by overlapping PCR using KOD-plus polymerase (ToYoBo) with the oligonucleotide pairs (IPS1 -1 S-BamH1/ IPS1 -522A-Sal1 ) and products of (a) to (b) as template. The products were digested with BamHI and Sail and directly cloned in the BamHI and Sail sites of pCAMBIA1301.

Table 7

Name of Primer Sequence (SEQ ID NO : 13-24) SEQ ID

BracQQTM S ATGGTGTTTGGACAAATAGTGATAG 32

BracQQT1-921A TTAAAACATCAAACTAAACTCAGAG 33 amiRNA-A CTGCAAGGCGATTAAGTTGGGTAAC 34 amiRNA-B G CG G ATAAC AATTTCAC ACAG G AAAC AG 35 bra-amiR1885b.3-ls gaATTGTGGACAAAGAAGGAAGtctctcttttgtattcc 36 bra-amiR1885b.3-lla gaCTTCCTTCTTTGTCCACAATtcaaagagaatcaatga 37 bra-amiR1885b.3*-llls gaCTCCCTTCTTTGTGCACAATtcacaggtcgtgatatg 38 bra-amiR1885b.3*-IVa gaATTGTG CACAAAG AAG G G AGtctacatatatattcct 39

IPS1-1 S-BamH1 gTggATCCAAgAAAAATggCCATCCCCTAgC 40

IPS1-522A-Sal1 ACgCgTCgACgAggAATTCACTATAAAgAgAATCg 41

MIRbra-1885b.3-la CTcttccttcttctatgtccacaatTTTCTAGAGGGAGATAA 42

MIRbra-1885b.3-lls AAattgtggacatagaagaaggaagAGCTTCGGTTCCCCTCG43

All the constructs were placed behind the constitutive CaMV 35S promoter in pCAMBIA2301 or pCAMBIA1301 vector. Constructs were introduced in planta by A. tumefaciens-mediated transformation. Plants were grown on soil in long days conditions (16 h light/8 h dark) under a mixture of cool and warm white fluorescent lights at 22°C and 65% humidity.

Method for identification of the heat-resistance of bra-miR1885b.3 and

BracQQTI:

(1 ) Identification of the resistance of basal thermotolerance or acquired

thermotolerance between wide type and transgenic plants:

For Arabidopsis, 2-week-old plants were exposed to 45°C for 1 h, for the basal thermotolerance assay and to 37°C for 1 h, 22°C for 3 h, and 49°C for 1 h for the acquired thermotolerance assays (modified from Ogawa et al. 2007). These plants were grown at 22C after HS treatment for 3 days (for basal thermotolerance assays) and 6 days (for acquired thermotolerance assays) before taking photographs and counting the number of surviving plants.

(2) Identification of small clusters of dead cells and localized H202 production between wide type and transgenic plants using Trypan blue staining and DAB staining respectively. For trypan blue staining, rosettes from 4-week-old wild-type and transgenic plants were boiled for 1 min in trypan blue staining buffer (12.5% phenol, 12.5% glycerol, 12.5% lactic acid, 48% ethanol, and 0.025% trypan blue) and incubated for 10 min at room temperature, followed by destaining (fivetimes) in 70% chloralhydrate. For DAB staining, rosettes from 4-week-old wild-type and transgenic plants were cut and placed in 1 mg/mL DAB solution (pH 3.8) overnight (about 8 h) at room temperature and subsequently cleared in 96% boiling ethanol for 10 min.

Results

Northern hybridization and real-time PCR showed that the novel miRNA bra- miR1885b.3 was heat-inhibitive and guided heat response of their target gene BracQQTI. To identify the heat resistance of miRNA/target, we constructed three vectors: p35S::bra- miR1885b.3, p35S::BracQQT1 (overexpressing BracQQTI), P35S::MIM bra-miR1885b.3 (mimicry bra-miR1885b.3 (Figure 7), which downregulates expression of bra-miR1885b.3 (Table 1 ), and detected heat resistance levels at 46°C for 1 hour.

Table 1 Heat resistance test of bra-miR1885b.3 and its target BracQQTI

Conclusion: Transgenic plants of Arabidopsis {Columbia ecotype) overexpressing bra- miR1885b.3 are more sensitive to heat stress relative to wild type, the transgenic plants with P35S::MIM bra-miR1885b.3 are resistant to heat stress at relatively low level, and p35S:: BracQQTI is resistant and provides potential for breeding of heat resistance.

Claims

1 . Isolated nucleic acid molecule comprising

(a) a nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2;

(b) a nucleotide sequence which is the complement of (a);

(c) a nucleotide sequence which has an identity of at least 80% to the sequence of (a) or (b); and/or

(d) a nucleotide sequence which hybridizes under stringent conditions to the sequence of (a), (b) and/or (c).

2. The nucleic acid molecule of claim 1 , wherein the identity of sequence (c) is at least 85%, preferably at least 90%, yet more preferably at least 95% to the sequence of (a) or (b).

3. A chimeric gene comprising a promoter active in plant cells operably linked to a nucleic acid sequence encoding the nucleic acid molecule according to any one of claims 1 or 2 and, optionally, further operably linked to a 3' untranslated nucleic acid molecule.

4. A vector comprising a nucleic acid sequence encoding the nucleic acid molecule according to any one of claims 1 or 2, or the chimeric gene according to claim 3.

5. A host cell comprising the chimeric gene according to claim 3 or the vector according to claim 5.

6. A host cell according to claim 5, wherein the host cell is a plant cell.

7. Plants or parts thereof comprising a plant cell according to claim 6.

8. Seeds derived from the plant of claim 7.

9. Use of the vector according to claim 4 for the transformation of plant cells to provide heat tolerant plants.

10. A method for preparing a plant and/or a part thereof with improved heat tolerance, said method comprising the step of decreasing the level of nucleic acid sequence having SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:1 ; and/or decreasing the binding capacity of said nucleic acid sequence having SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:1 to its target and/or decreasing the capacity of said nucleic acid sequence having SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:1 to cleave its target in said plant.

1 1. A method according to claim 10, in which the step of decreasing the level of the nucleic acid sequence having SEQ ID NO: 1 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:1 , and/or decreasing the binding capacity of said nucleic acid sequence having SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:1 to its target and/or decreasing the capacity of said nucleic acid sequence having SEQ ID NO: 1 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:1 to cleave its target in said plant, in said plant comprises one or more steps selected from the group consisting of:

- downregulating expression of a nucleic acid sequence encoding a nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2;

- mutating the nucleic acid sequence encoding a nucleotide sequence as shown in

SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2 as to reduce or eliminate binding of SEQ ID NO:1 to its mRNA target and/or to reduce or eliminate cleaving of the mRNA corresponding to the target after binding of SEQ ID NO:1 thereto;

- contacting said plant with a compound capable of decreasing transcription of the nucleic acid sequence encoding a nucleotide sequence as shown in SEQ ID NO:1 or a precursor thereof as shown in SEQ ID NO:2, or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO: 1 or a precursor thereof as shown in SEQ ID NO:2; and

12. A method for producing a plant and/or a part thereof with improved heat tolerance, 5 said method comprising the step of increasing the level of mRNA corresponding to the

nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3; and/or mRNA corresponding to a nucleic acid sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid

10 sequence of SEQ ID NO:5; and/or decreasing the binding capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:3 or of mRNA

corresponding to a nucleotide sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the

15 amino acid sequence of SEQ ID NO:5, to SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 and/or decreasing the capacity of said mRNA corresponding to said nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:3 or mRNA corresponding to a nucleotide sequence encoding

20 a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5 to be cleaved by SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 in said plant.

25 13. A method according to claim 12, in which the step of increasing the level of mRNA corresponding to a nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, and/or of mRNA corresponding to a nucleic acid sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least

30 70% to the amino acid sequence of SEQ ID NO:5, and/or decreasing the binding capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:3 or of mRNA corresponding to a nucleotide sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least

35 70% to the amino acid sequence of SEQ ID NO:5, to SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO: 1 and/or decreasing the capacity of said mRNA corresponding to the nucleic acid sequence having SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:3 or of mRNA corresponding to a nucleotide sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, to be cleaved by SEQ ID NO: 1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 , in said plant comprises one or more steps selected from the group consisting of:

- mutating a gene encoding an mRNA corresponding to a nucleotide sequence as shown in SEQ ID NO:3 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, or a nucleic acid sequence encoding the protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5 as to reduce or eliminate binding of SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO: 1 to mRNA corresponding to SEQ ID NO:3 or said nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, or of mRNA corresponding to said nucleic acid sequence encoding the protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, and/or to reduce or eliminate cleaving of mRNA corresponding to SEQ ID NO:3 or said nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:3, or of mRNA corresponding to a nucleic acid sequence encoding the protein sequence having the amino acid sequence of SEQ ID NO:5 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:5, after binding of SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 thereto.

14. A method for producing a plant and/or a part thereof with improved heat tolerance, said method comprising the step of increasing the level of mRNA corresponding to the nucleic acid sequence having SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, and/or of mRNA corresponding to a nucleic acid sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, and/or decreasing the binding capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:4 or of mRNA

corresponding to a nucleotide sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, to SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 ; and/or decreasing the capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:4 or of mRNA corresponding to a nucleotide sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, to be cleaved by SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 , in said plant.

15. A method according to claim 14, in which the step of increasing the level of mRNA corresponding to the nucleic acid sequence having SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, or of mRNA corresponding to a nucleic acid sequence encoding the protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6; and/or the step of decreasing the binding capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:4 or of mRNA corresponding to a nucleotide sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, to SEQ ID NO:1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 ; and/or the step of decreasing the capacity of mRNA corresponding to said nucleic acid sequence having SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 80% to the nucleic acid sequence of SEQ ID NO:4 or of mRNA

corresponding to a nucleotide sequence encoding a protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, to be cleaved by SEQ ID NO: 1 or a nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 , in said plant comprises one or more steps selected from the group consisting of:

- mutating a gene encoding an mRNA corresponding to the nucleotide sequence as 5 shown in SEQ ID NO:4 or a nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, or a nucleic acid sequence encoding the protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid sequence of SEQ ID NO:6, as to reduce or eliminate binding of SEQ ID NO:1 or a nucleotide sequence which has an identity of at least

10 80% to the nucleotide sequence as shown in SEQ ID NO:1 to mRNA corresponding to the nucleotide sequence of SEQ ID NO:4 or said nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, or to mRNA corresponding to said nucleic acid sequence encoding the protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least 70% to the amino acid

15 sequence of SEQ ID NO:6; and/or to reduce or eliminate cleaving of mRNA corresponding to the nucleic acid sequence of SEQ ID NO:4 or said nucleotide sequence which has an identity of at least 70% to the nucleic acid sequence of SEQ ID NO:4, or of mRNA

corresponding to said nucleic acid sequence encoding the protein sequence having the amino acid sequence of SEQ ID NO:6 or a protein sequence which has an identity of at least

20 70% to the amino acid sequence of SEQ ID NO:6, after binding of SEQ ID NO:1 or a

nucleotide sequence which has an identity of at least 80% to the nucleotide sequence as shown in SEQ ID NO:1 thereto.

16. Use of the nucleic acid molecule according to any one of claims 1 or 2, or a gene 25 encoding said nucleic acid molecule, for modulating heat tolerance of a plant.

17. Use of the nucleic acid molecule according to any one of claims 1 or 2, or a gene encoding said nucleic acid molecule, in a method for genetic analysis or marker assisted selection for providing heat tolerant plants.

30

18. Use of the nucleic acid molecule according to any one of claims 1 or 2, or a gene encoding said nucleic acid molecule, in a method of plant breeding for providing heat tolerant plants.