Account Options

  1. Sign in
    Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.

    Patents

    1. Advanced Patent Search
    Publication numberCA2490154 A1
    Publication typeApplication
    Application numberCA 2490154
    PCT numberPCT/US2003/019212
    Publication dateDec 31, 2003
    Filing dateJun 17, 2003
    Priority dateJun 22, 2002
    Also published asCN1668744A, EP1517991A2, EP1517991A4, US20040034889, US20060260012, WO2004000006A2, WO2004000006A3
    Publication numberCA 2490154, CA 2490154 A1, CA 2490154A1, CA-A1-2490154, CA2490154 A1, CA2490154A1, PCT/2003/19212, PCT/US/2003/019212, PCT/US/2003/19212, PCT/US/3/019212, PCT/US/3/19212, PCT/US2003/019212, PCT/US2003/19212, PCT/US2003019212, PCT/US200319212, PCT/US3/019212, PCT/US3/19212, PCT/US3019212, PCT/US319212
    InventorsRafiqul Khan
    ApplicantSyngenta Participations Ag, Rafiqul Khan
    Export CitationBiBTeX, EndNote, RefMan
    External Links: CIPO, Espacenet
    Method of transforming soybean
    CA 2490154 A1
    Abstract
    The present disclosure provides methods for Agrobacterium-mediated transformation of soybean cells or tissue and regeneration of the transformed cells or tissue into transformed plants. The methods may be used for transforming many soybean cultivars.
    Claims(22)
    1. A method for transforming soybean cells or tissue, comprising:
    (a) preparing an explant from a soybean seed by:
    (i) removing a hypocotyl from said soybean seed;
    (ii) removing one cotyledon along with its adjacent axillary bud, leaving primary leaves attached to a remaining cotyledon; and (iii) removing a portion of a primary leaf from said remaining cotyledon, thereby generating a primary leaf base; and (b) co-cultivating said explant with Agrobacterium comprising at least one nucleic acid of interest to be incorporated into a genome of one or more soybean cells.
    2. The method of claim 1, further comprising cultivating at least one formed shoot in a medium containing a selection agent.
    3. The method of claim 2, wherein said at least one nucleic acid of interest comprises a selectable marker gene.
    4. The method of claim 3, wherein said selectable marker gene is a phosphomannose isomerase gene.
    5. The method of claim 4, wherein said selection agent is mannose.
    6. The method of claim 4, wherein co-cultivation with said Agrobacterium is carried out in the presence of mannose.
    7. The method of claim 2, further comprising inducing shoot formation from said primary leaf base.
    8. The method of claim 7, wherein shoot formation is induced by culturing said primary leaf base in a medium comprising a shoot-inducing hormone.
    9. The method of claim 8, wherein said shoot-inducing hormone comprises at least one of an auxin, a cytokinin, and a gibberellic acid.
    10. The method of claim 9, wherein said auxin is selected from the group consisting of IAA, NAA, and IBA.
    11. The method of claim 9, wherein said cytokinin is selected from the group consisting of benzylaminopurine (BAP), thidiazuron, kinetin, and isopentenyl adenine.
    12. The method of claim 7, wherein induction of shoot formation comprises removing one or more of a primary meristem, a secondary meristem, and an axillary meristem attached to a cotyledon.
    13. The method of claim 7, further comprising selecting a transformed shoot.
    14. The method of claim 13, further comprising regenerating a selected transformed shoot into a soybean plant.
    15. The method of claim 1, wherein said soybean seed is a mature seed.
    16. The method of claim 1, wherein said soybean seed is an immature seed.
    17. The method of claim 1, wherein said soybean seed is a germinated seed.
    18. A method for producing a stably transformed soybean plant, comprising:
    (a) preparing an explant from a soybean seed by:
    (i) removing a hypocotyl from said soybean seed;
    (ii) removing one cotyledon along with its adjacent axillary bud, leaving primary leaves attached to a remaining cotyledon; and (iii) removing a portion of each primary leaf from said remaining cotyledon, thereby generating a pair of primary leaf bases;
    (b) co-cultivating said explant with Agrobacterium comprising a nucleic acid of interest to be incorporated into a genome of a soybean cell;
    (c) inducing shoot formation from each primary leaf base;
    (d) cultivating at least one formed shoot in a medium containing a selection agent;
    (e) selecting a transformed shoot; and (f) regenerating a selected transformed shoot into a soybean plant.
    19. A transgenic soybean plant regenerated from soybean cells or tissue transformed according to the method of claim 1.
    20. A transgenic seed produced by the transgenic plant of claim 19.
    21. A transgenic soybean plant regenerated from soybean cells or tissue transformed according to the method of claim 18.
    22. A transgenic seed produced by the transgenic plant of claim 21.
    Description  (OCR text may contain errors)

    METHOD OF TRANSFORMING SOYBEAN
    CROSS REFERENCE TO RELATED APPLICATIONS
    This application claims the benefit of United States Provisional Application Serial No. 601390,562, filed June 22, 2002, the entire contents of which is hereby incorporated by reference.
    FIELD OF THE INVENTION
    The invention relates generally to methods for plant transformation and, more particularly, to methods fox transforming soybean cells or tissues. The invention also relates to methods for regenerating transgenic soybean plants from transformed soybean cells or tissues. The invention also relates to transgenic soybean plants and seeds obtained by such methods.
    BACKGROUND
    Soybean is a major food and feed source that is grown on more acres worldwide than any other dicotyledonous crop. It is reportedly grown on more than 50 million hectares. Unfortunately, only a few plant introductions have given rise to the major cultivars grown in the United States and, as a consequence, this narrow germplasm base has limited soybean breeding potential. The limited genetic base in domestic soybean varieties has limited the power of traditional breeding methods to develop varieties with improved or value-added traits.
    Hence, the use of genetic engineering techniques to modify soybean can facilitate the development of new varieties with, for example, traits such as herbicide resistance, disease resistance (such as virus resistance, for example), and seed quality improvement in a manner that has been unattainable by traditional breeding methods or tissue-culture induced variation.
    The development of an efficient transformation system is necessary for the analysis of gene expression in plants. The requirements for such a system include a pxoper target plant tissue that will allow efficient plant regeneration, a gene delivery I

    vehicle that delivers foreign DNA efficiently into the target plant cells, and an effective method for selecting transformed cells. In genetic transformation of dicotyledonous species, transformation systems utilizing the bacterium Agrobacteriunt tumefaciens have been frequently used as vehicles for gene delivery. The preferred target tissues for Agrobacterium-mediated transformation presently include cotyledons, leaf tissues, and hypocotyls. High velocity microprojectile bombardment offers an alternative method for gene delivery into dicotyledonous plants.
    Agrobacterium-mediated gene delivery in soybean has been far from routine. In reports that have been available to the public, meristcms and cotyledon tissues have been frequently mentioned as targets fox use in Agrobacterium-mediated gene delivery.
    However, reliable and efficient transformation and regeneration from these two explant sources are often not accomplished.
    U.S. Patent No. 5,169,770 and 5,376,543 to Chee et al. discuss a non-tissue culture method of transforming soybeans to produce transgenic plants, wherein seeds are germinated and meristematic or mesocotyl cell tissues are inoculated with bacterial cells, specifically Agrobacterium strains, which, through infection, transfer DNA
    into the explants. This method depends on the growth of preformed shoots.
    Parrott W.A. et al. ( 1989), "Recovery of primary transformants of soybean,"
    Plant CeII Reports 7:615-617, report recovery of soybean transformants from immature cotyledon tissue after co-cultivation with Agrobacterium. However, the regenerated plants were chimeric, and the transgenes were not transmitted to the progeny.
    U.S. Patent No. 5,416,011 (to Hinchee et aL) discusses utilizing a cotyledon explant, which requires removal of the hypocotyl, saving and separating the cotyledons and inserting a chimeric gene by inoculation with Agrobacteriurn tumefaciens vectors containing the desired gene.
    Yan B. et al. (2000), "Agrobacterium tumefaciens - mediated transformation of soybean using immature zygotic cotyledon explants," Plant Cell Reports 19:1090-1097, report an overall 0.03% transformation frequency in Agrobacterium-mediated transformation in soybean with immature cotyledons.
    U.S. Patent No. 6,384,301 to Martinell et al. describes Agrobacterium-mediated gene delivery into cells in the meristem of an isolated soybean embryonic axis. Their method does not involve a callus-phase tissue culture.
    From the work described above, it is clear that the goal of establishing a reliable soybean transformation system is seldom accomplished by the workers involved when mcriaten~s and cotyledon tissues arc usCel us source explants for ~lgrnJ~acterium-mediated gene delivery. Therefore, there is a need to continue to exploit new methodology, including new source explants, in order to develop a more efficient soybean transformation system. ' It has bee~~ demonstrated in soybean tissue culture that plant regeneration may be achieved from epicotyl tissues and primary leaf tissues. However, to-date, no successful transformation has been reported in soybean using these two explant sources as targets for gene delivery.
    Wright M.S. et al. (1987) "Initiation and propagation of Glycine max L. Merr.:
    Plants from tissue-cultured epicotyls," Plant Cell Reports 8:83-90, describes successful initiation and proliferation of shoots from epicotyl tissue of soybean.
    Explanted epicotyls were induced to form shoots in Schenk and Hildebrandt medium containing 20 ~.M
    kinetin for 5 weeks. Shoot proliferation was maintained on N6 medium containing 2.1 nM picloram and 0.1 ,uM benzyladenine.
    Writ;ht M.S. et al. (1987) "Regeneration of soybean (Glycine max L. Merr.) from cultured primary leaf tissue," Plant Cell Reports 6:83-89, describes a reproducible method for regeneration of plants from primary leaf tissue of 27 varieties of soybean They found that while 2,4,5-trichlorophenoxyacetic acid was demonstrated to be essential fox regeneration, addition of benzyadenine (BA) was found to enhance regeneration.

    Rajaselcarcn ~~. et al, (1997) "Somatic embryogenesi.s from cultured epicotyls and primary leaves of soybean (Glycine max L. Merr)," In Vitro Cellular &
    Developmental Biology 33(2):88-9I, describes regeneration of several varieties of soybean by somatic embryogenesis from cultured epicotyls and primary leaf tissues of immature seeds from greenhouse grown plants. They found that somatic embryogenesis was induced from epicotyls and primary leaves when cotyledon halves with the intact zygotic embryo axes were cultured on Murashige and Skoog (MS) medium supplemented with 46.2 ~M 2,4-D.
    In the absence of being cultured with the cotyledon halves, no embryogenesis was observed from isolated axes, epicotyls or primary leaves. Rapid multiplication of shoot tips from germinating somatic embryos was achieved on Cheng's basal medium containing 11.3 ,uM benzyladenine.
    SUMMARY
    The present invention provides a method for transforming soybean cells and regeneration of the transformed cells into transformed plants. The method may be used for transforming many soybean cultivars.
    The invention provides a novel soybean explant that enables Agrobacterium tumcfacict~s-mediated gene delivery into soybean cells with high efficiency.
    In particular, the invention provides a method for transforming soybean cells or tissue, the method comprising:
    (a) preparing an explant from a soybean seed by:
    (i) removing all or a part of the hypocotyl from said seed;
    (ii) removing one cotyledon along with its adjacent axillary bud from the seed, and leaving one cotyledon with the epicotyl and primary leaves attached thereto;
    (iii) removing a portion of a primary leaf from the remaining cotyledon, thereby generating a primary leaf base; and (b) co-cultivating the explant with AgrobacteriunZ comprising a nucleic acid of interest to be incozporated into the genome of the soybean cells.

    In additional embodiments, the method further includes one or more of the following: inducing shoot formation from the primary Leaf base and the adjacent epicotyl; cultivating the shoot in a medium containing a selection agent;
    selecting a transformed shoot; and regenerating a transformed plant from the transformed shoot.
    In a further embodiment, the invention provides a method for producing a stably transformed soybean plant, the method comprising:
    (a) preparing an explant from a soybean seed by:
    (i) removing all or a part of the hypocotyl from said seed;
    (ii) removing one cotyledon along with its adjacent axillary bud from the seed, and leaving one cotyledon with the epicotyl and primary leaves attached thereto;
    (ii) removing a portion of a primary leaf from the epicotyl, thereby generating at least one primary leaf base;
    (b) co-cultivating the explant with Agrobacterium comprising a nucleic acid of interest to be incorporated into the genome of the soybean cells;
    (c) inducing shoot formation from the primary leaf base area;
    (d) .cultivating a formed shoot in a medium containing a selection agent;
    (e) selecting a transformed shoot; and (f) regenerating a selected transformed shoot into a soybean plant.
    In another embodiment, a portion of each of the primary leaves of the explant generated in (a)(ii) is removed, thereby generating a pair of primary leaf bases.
    The method of the invention may be employed to introduce any desired nucleic acid into a soybean cell. In one embodiment of the invention, the nucleic acid comprises a gene that would express a desirable agronomic trait in soybean.
    111 another embodiment of the invention, the nucleic acid comprises a phosphomannose isomerase gene, which is used as a selectable marker gene.

    In an additional embodiment of the invention, the co-cultivating of the explant with Agrobacteriuna is carried out in the presence of mannose.
    Both mature and immature seeds may be employed to generate the explant used in the present invention.
    BRIEF DESCRIPTION OF THE FIGURES
    FIG. 1 shows a map of plasmid pNOV21 OS.
    FIG. 2 shows a map of plasmid pNOV214S.
    FIG. 3 shows a map of plasmid pNOV2147.
    FIG. 4 shows an exemplary process for preparing a soybean explant. Panel A
    depicts a soybean seed embryo in which a part of the hypocotyl is removed.
    Panel B
    depicts the soybean explant from Panel A in which one cotyledon is removed along with its adjacent axillary bud. Panel C depicts the soybean explant from Panel B
    after removal of the two primary leaves, generating a break point at the base of each primary leaf.
    FIG. S shows a map of plasmid pBSC11234.
    FIG. 6 shows a rnap ofplasmid pBSC11369.
    DETAILED DESCRIPTION
    The present invention will now be described more fully hereinailer with reference to the accompanying figures, in which various embodiments of the invention are described. This invention may, however, be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete and will fully convey the scope of the invention to those skilled in the art. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used in the description of the invention and the appended claims, the singular forms "a", ."an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.
    Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this InVCntiC)n ~)C1011~1,.~~.
    Except as otherwise indicated, standard methods may be used for the production of cloned genes, expression cassettes, vectors (e.g., plasmids), proteins and protein fragments, and transformed cells and plants according to the present invention. Except as otherwise indicated, standard methods may be used for the production of cloned genes, expression cassettes, vectors (e.g., plasmids), proteins and protein fragments according to the present invention. Such techniques are known to those skilled in the art.
    See e.g., J.
    Sambroolc et al., Molecular Cloning: A Laboratory Manual Second Edition (Cold Spring Harbor Laboratory, Cold Spring Harbor, New Yorlc, 1959), and F. M. Ausubel et al., Current Protocols In Molecular Biology (Green Publishing Associates, Inc. ~
    and Wiley-Interscience, New York, 1991); J. Draper et al., eds., Plant Genetic Transformation And Gene Expression: A Laboratory Manual, (Blaclcwell Scientific Publications, 1958); and S.B. Gelvin & R.A. Schilperoort, eds., Introductiozz, Expression, And Analysis Of Gene Production In Plazzts.
    The present invention is drawn to methods and compositions for, the stable transformation of soybean with nucleic acid sequences of interest and the regeneration of transgenic soybean plants.
    The methods of the invention may be employed to express any nucleic acid of interest in soybean plants. A'gene of interest may be, for example, a gene for herbicide resistance, disease resistance, or insect/pest resistance, or is a selectable' or scorable marker, and comprises a plant-operable promoter, a coding region, and a 3' terminator region. Herbicide resistance genes include the AHAS gene for resistance to imidazolinone or sulfonyl urea herbicides, the pat or bar gene for resistance to bialaphos or glufosinate, the EPSP synthase gene for resistance to glyphosate, etc.
    Disease resistance genes include genes for antibiotic synthetic enzymes, e.g., for pyrrolnitrin synthetic enzymes, plant derived resistance genes, and the like. Insect resistance genes include genes for insecticidal proteins from Bacillus thuringiensis. Genes of interest may also encode enzymes involved in biochemical pathways, the expressiow of which afters a trait that is important in food, feed, nutraceutical, and/or pharmaceutical production. The gene of interest may be located on a plasmid. A plasmid suitable for use in ihc present iIIVCI1t1011 play comprise more tllan one gene of interest and/or the Agrobacterium may comprise different plasmids having different genes of interest.
    The present invention provides a method for the transformation of varieties of soybean, including Glycine max. The method is based on Agrobacteriurn-mediated delivery oC a desired gene into a soybean cell followed by regeneration of transformed cells) into a transformed soybean plant. The methods of the invention are cultivar independent.
    In one embodiment of the invention, an explant is prepared by germinating a soybean mature seed or immature seed collected from a greenhouse groom plant in a seed germination medium for a period of time, removing seed coat and, subsequently, a cotyledon froze said mature seed or immature seed. In a preferred embodiment of the invention, a portion of the exposed primary leaves is then removed, thereby creating a break point at the primary leaf base (FIG. 4). Agrobacterium-mediated gene delivery is made into the cells at the primary leaf base or in the area of the primary leaf break point.
    Adventitious shoots are induced from the primary leaf base area of the epicotyl. This induction is achieved by removing pre-existing meristems (i.e., primary, secondary, and axillary mcristems) and subjecting the explant to a shoot induction medium containing appropriate growth regulators: The shoot induction process facilitates the development or regeneration of transformed shoots from the targeted primary leaf base cells.
    Transformed soybean cells are cultured in the presence of a selection agent.
    Preferably, the cells are transformed with a phosphomannose isomerase (PMI) gene, and the transformed cells are cultivated in the presence of marlnose. In a medium that contains mannose as a selection agent, soybean cells transformed with a PMI
    gene have a growth advantage ovex those that are not so transformed.
    The time required for regenerating a transformed soybean plant using the method described in this invention is significantly reduced compared to other Agrobacterium-mediated transformation protocols that are reported in the literature. A
    rooted transformed soybean shoot may be produced 8 to 12 weeks from the initiation of a transformation experiment. A foreign genetic construct, ox transgene, to be inserted into the soybean t;enome is created in vitro by normal techniques of recombinant DNA
    manipulations. The construct may be comprised of any heterologous nucleic acid. The genetic construct is transformed into the Agrobacteriuln strain for delivery into the st~yboun c;clla. 'l'hc A<rl'lJI7ClclG'l'llllll IS 11011-ollCOgC111C, and several such strains are now widely available. The Agrobacteriurra is preferably selected from A.
    tulnefaciens and A.
    rhizogenes.
    The foreign genetic construct preferably comprises a selectable marker gene.
    The preferred selectable marker gene is a phosphomannose isomerase gene. Other suitable selectable marker genes include, but are not limited to, genes encoding:
    neomycin phosphotransferase II (Fraley et al., CRC Critical Reviews in Plant Science 4, 1 (1986));
    cyanamide hydratase (Mater-Greiner et al., Proc. Natl. Acad. Sci. USA 88, 42.50 (1991));
    aspartate kinase; dihydrodipicolinate synthase (Pert et al., ~BioTechnolog~
    11, 715 (1993)); bar gene (Toki et al., Plant Physiol. 100, 1503 (1992); Meagher et al., Crop Sci.
    36, 1367 (1996)); tryptophane decarboxylase (Goddijn et al., Plant Mol. Biol.
    22, 907 (1993)); neomycin phosphotransferase (NEO; Southern et al., J. Mol. Appl.
    Gerz. 1, 327 (1982)); hygromycin phosphotransferase (HPT or FIYG; Shimizu et al., Mol.
    Cell. Biol. 6, 1074 (1986)); dihydrofolate reductase (DHFR); phosphinothricin acetyltransferase (DeBlock et al., EMBO J. 6, 2513 (1987)); 2,2- dichloropropionic acid dehalogenase (Buchanan-Wollatron et al., J. Cell. Biochenl. 13D, 330 (1989));
    acetohydroxyacid synthase (United States Patent No. 4,761,373 to Andexson et al.; Haughn et al., Mol. Gen.
    Genet. 221, 266 (1988)); 5-enolpyruvyl-shikimate-phosphate synthase (aroA;
    Comai et al., Nature 317, 741 (1985)); haloarylnitrilase (WO 87/04181 to Stalker et al.); acetyl-coenzyme A carboxylase (Parker et al., Plant Physiol. 92, 1220 (1990));
    dihydropteroate synthusc (sul.i; Gucrincau of al., Plant Mol. Biol. 15, 127 (1990)); and 32 kDa photosystem II polypeptide (psbA; Hirschberg et al., Science 222, 1346 (1983)).
    Also included are genes encoding resistance to chlorampbenicol (Herrera-Estrella et al., EMBO J 2, 987 (1983)); methotrexate (Hezrera-Estrella et al., Nature 303, 209 (1983); Meijer et al., Plant Mol. Biol. 16, 807 (1991)); hygromycin (Waldron et al., Plant Mol. Biol. 5, 103 (1985); Zhijian et aL, Plant Science 108, 219 (1995); Meijer et. al., Plant Mol. Bio. 16, 807 (1991)); streptomycin (Jones et al., Mol. Gen. Genet. 210, 86 (1987));
    spectinomycin (Bretagne- Sagnard et al., Transgenic Res. 5, 131 (I996));
    bleomycin (Hille et al., Plant Mol. Biol. 7, I71 (1986)); sulfonamide (Guerineau et al., Plant Mol.
    Bio. 15, 127 (1990); broixzoxynil (Stalker et al., Science 242, 419 (1988));
    2,4-D (Streber et al., BiolTechnology 7, 811 (1989)); phosphinothzzcin (DeBlock et aL, EMBO
    J. 6, 2513 (1987)); spectinomycin (Bretagne-Sagnard and Chupeau, Transgenic Research 5, (1996)).
    In one embodiment, the starting material for the transformation process is a soybean mature seed. In another embodiment, the starting material can be a soybean immature scud from a growing soybean plant. The seed is placed on a germination medium and permitted to germinate for a period of 6-24 hours, preferably for about 6-14 hours, and more preferably for about 8-12 hours. Seeds may also be allowed to germinate for a longer period of time, for example, from 2 to 5 days, if desired.
    The seed coat and hypocotyl of the germinating seed is removed. One cotyledon along with its adjacent axillary shoot bud is also removed. Afterwards, the primary leaves are substantially removed, thereby creating an explant comprising the primary leaf base, epicotyl to which the leaf base is attached, and a cotyledon to which the epicotyl is attached. Substantially removed means removal of a major portion of primary leaf tissue.

    For Agrobacterium-mediated gene transfer, wounding of the plant tissue is known to facilitate gene ,transfer. Therefore it is preferred, but not necessary, that a wound is created at the leaf base region.
    The explant, prepared as described above, is then immersed into an Agrobuclerium cell suspension for a few minutes to a few hours, typically about 0.5-3 hours, and preferably 1-2 hours. Excessive Agrobacterium cell suspension is removed and the remaining Agrobacterium are permitted to co-cultivate with the explant on a co-CliltlvFlt1011 171CClllll17 for several days, typically two to five days, and preferably three to four days, under 16h light/8h dark conditions at a temperature of about 22° C ~ 2° C.
    After co-cultivation, the explant is transferred to a medium (or a series of media) conducive to shoot development and selection of transformed cells, for 8-12 weeks. Such a medium (or media) generally contains a shoot-inducing hormone as well as a selection agent. The regeneration media used in the examples below contain mannose, as the SLI(:C~lUi1 agCnt, us wc;ll us bCil~y1~1t111110p1t1'111C (13AP), a shoot-inducing hormone. The term hormone also includes cell growth regulating compounds that induce shoot formation, including, but not limited to, auxins (such as, e.g., IAA, NAA, and indole butyric acid (IBA)), cytokinins (such as, e.g., thidiazuron, kinetin, and isopentenyl adenine), and/or gibberellic acids (GA3).
    When shoots reach about 2 cm and with full trifoliate leaf formation; shoots are separated from the explant and placed on a rooting medium to induce root formation.
    Preferably, the rooting medium also contains a selection agent to further help identify potential transformed shoots. Root formation takes approximately 1-2 weeks, following which the plants can be transferred to soil and grown to full maturity.
    Transgenic plants comprising a heterologous nucleic acid (i.e., comprising cells or tissues transformed in accordance with the methods described herein), as well as the seeds and progeny produced by the transgenic plants, are an additional aspect of the present invention. Procedures for cultivating transformed cells to useful cultivars are known to those skilled in the art. Techniques are known for the in vitro culture, of plant tissue, and in a number of cases, for regeneration into whole plants. A
    further aspect of the invention is trans~;enic plant tissue, plants, or seeds containing the nucleic acids described above. In a preferred embodiment, transformed plants produced using the methods described herein are not chimeric, or only a small proportion of transformed plants is chimeric. This is preferably achieved by extending the period of high cytokinin treatment or by increasing the stringency of mannose selection, or both.
    Thus, the transformed cells of the present invention, identified by selection or screening and cultured in an appropriate medium that supports regeneration as provided herein, may then be allowed to mature into plants. Plants are preferably matured either in a growth chamber or greenhouse. Plants. are regenerated from about 2-6 weeks after a transformant is identified, depending on the initial tissue. During regeneration, cells may be grown on solid media in tissue culture vessels. Illustrative embodiments of such vessels are petri dishes and Plant Cori s. After the regenerating plants have reached the stage of shoot and root development, they may be transferred to a greenhouse for further growth and testing. As provided above, seeds and progeny plants of the regenerated plants are an aspect of the present invention. Accordingly, the term "seeds"
    is meant to encompass seeds of the transformed plant, as well as seeds produced from the progeny of the transformed plants. Plants of the present invention include not only the transformed and regenerated plants, but also progeny of transformed and regenerated plants produced by the methods described herein.
    Plants produced by the described methods may be screened for successful transforniation by standard methods described above. Seeds and progeny plants of regenerated plants of the present invention may be continuously screened and selected for the continued presence of the transgenic and integrated nucleic acid sequence in order to develop improved plant and seed lines, which are another aspect of the present invention.
    Desirable transgenic nucleic acid sequences may thus be moved (i.e., introgressed or inbred) into other genetic lines such as certain elite or commercially valuable lines or varieties. Methods of introgressing desirable nucleic acid sequences into genetic plant lines may be carried out by a variety of techniques known in the, art, including by classical breeding, protoplast fusion, nuclear transfer and chromosome transfer. Breeding approaches and techniques are known in the art, and are set forth in, for example, J. R.
    Welsh, Fundamentals of Plant Genetics and Breeding (John Wiley and Sons, New York, (1981)); Crop Breeding (D. R. Wood, ed., American Society of Agronomy;
    Madison, Wisconsin, (1983)); O. Mayo, The Theory of Plant Breeding, Second Edition (Clarendon Press, Oxford, England (1987)); and Wricke and Weber, Quantitative Genetics and Selection Plant Breeding (Walter de Gruyter and Co., Berlin (1986)). Using these and other techniques in the art, transgenic plants and inbred lines obtained according to the present invention may be used to produce commercially valuable hybrid plants and crops, which hybrids axe also an aspect of the present invention.
    The foregoing is illustrative of ihc various embodiments of the present invention and is not to be construed as limiting thereof.
    The invention will be further described by the following examples, which are not intended to limit the scope of the invention in any manner.

    Transformation Vectors The plasmid pNOV2105 (FIG. 1 ) is a modification of pVictor, which is disclosed and described in WO 97/04112 in that the 35S promoter is replaced with a SMAS
    promoter, the 35S terminator is replaced with the Nos terminator, and an additional SMAS promoter is inserted upstream of the GUSintronGUS sequence, which is flanked on its 3' end by a Nos terminator. pNOV2105 employed in the methods described herein does not contain the multicloning site that is found in pVictor. However, it is well within the skill in the art to add such a cloning site, if desired.
    pNOV210S (FIG. 1) is a vector forAgrobacterium-mediated plant transformation and contains the Ti right and left border sequences from the nopaline type pTiT37 plasmid (Yadav et al. 1982 Proc Natl Acad Sci 79:6322-6326) flanking the genes phosphomannose isomerase (PMI) and beta-glucoronidase (GUS).
    For replication and maintenance in E. coli, the plasinid contains the origin of replication from the E. coli plasmid pUCl9 (pUCl9ori) (Yanish-Perron et al.
    1985 Gene 33:103-119), and for replication and znaintcnancc in Agrobacteriurn tuntefaciens the plasmid further contains the origin of replication from the Pseudomonas plasmid pVS 1 (pVSlori) (Itoh et al. 1984 Plasmid 11:206-220; Itoh and Haas 1985 Gene 36:27-36). For selection in E. coli and Agrobacteriurn turnefaciens, the plasmid contains the spectinomycin/streptomycin resistance gene (spec/strep) from the transposon Tn7 encoding the enzyme 3"(9)-0-nucleotidyltransferase (Fling et aI. 1985 Nucleic Acids Res 19:7095-7106). The spec/strep resistance gene is fused to the tae promoter (see, e.g., Amann et al. 1983 Gene 25(203):167-78) for efficient expression in the bacterium.
    The T-DNA segment between the right and left border harbors the following genes, which are the only genes transferred to the soybean plant via the Agrobacterium tumefaciens-mediated transformation.
    GUSintrortGUS
    beta-glucuronidase (GUS): This segment next to the right border contains the beta-glucuronidase gene (GUS) from E. coli with an intron in the coding region to prevent translation by Agrobacteriurn fused to the SMAS promoter and Nos terminator.
    The GUSintronGUS gene was isolated from plasmid pBISNl. (Narasimhulu et al.

    Early transcription of Agrobacteriunr DNA in tobacco and maize, Plant Cell 8:873-866).
    phosphomannose isomerase (PMI): This segment next to the leis; border is the mannose-6-phosphate isomerases gene from E. coli (Miles and Guest 1984, Gene 32:41-48 ) fused to the SMAS promoter (Ni M, Cui D, Einstein J, Narasimhulu S, Vergara CE, Gelvin SB (1995) and Nos terminator. The phosphomannose isomerase gene is used as a selection marker to select transgenic shoots on media containing D-mannose as the carbon source.

    The components and sequence of pNOV2145 (FIG. 2) are set forth in SEQ ID
    N0:1. The components and sequence of pNOV2147 (FIG. 3) are set forth in SEQ ID
    N0:2.

    Transformation and Regeneration Mature dried soybean seeds (Var. S42 H1) were surface sterilized by releasing chlorine gns inside a dcsiccator. Seeds were kept in petri plates and chlorine gas was produced by pouring 100 1111 of Clorox into a beaker and slowly adding 8 ml of concentrated HCl. Seeds were sterilized by at least two gas release treatments each lasting for 8-18 hours.
    Sterilized seeds (approximately 1 S-20 seeds per plate) were then .placed on a germination medium containing 0.6% agar-solidified MS basal medium (Murashige and Skoog (1962) A revised medium for rapid growth and bioassays with tobacco callus cultures. Physiol Plant 15: 473-479) and 2% sucrose. The pH was maintained at 5.8.
    The petri plates were placed in a room at 37° C for overnight growth or imbibition of seeds. The seed coat was removed, followed by removing part of the hypocotyl, keeping about 0.5 cm of the hypocotyl. One cotyledon was removed along with. its adjacent axillary shoot b~,zd and was discarded. On the remaining cotyledon, the primary leaves were broken apart using a scalpel, leaving the primary leaf bases on the epicotyl.
    (FIG. 4) Agrobacterium strain (LBA 4404) containing the plasmid pNOV 2145 (ZsGreenl and PMI, as described in Example 1) was streaked from frozen glycerol stocks onto YEP
    plates (yeast extract 10 glL, peptone 5 g/L, NaCI Sg/L, bacto agar 15 g/L) containing appropriate antibiotic (100 mg/L spectinomycin). Agrobacterium was then incubated at 27° C for 1-2 days. A scoop of Agrobacterium from plates were grown on 100 ml YEP
    liquid medium containing an antibiotic (100 mg/L spectinomycin) for overnight growth at 27° C on a shaker. Bacterial suspensions were centrifuged at about 1500 g for 15 minutes and resuspended to a density of OD sso .= 0.2 or 0.65 in a co-cultivation liquid medium (BS salts O.OSX (Sigma), BS vitamins' (0.05X) (BS vitamin composition (1X):
    inositol 100 mg/L, nicotinic acid 1 mg/L, pyridoxine HCl 1 mg/L, thiamine HCI
    10 mg/L), acetosyringone 40 mg/L, sucrose 20 g/L, BAP 2 mg/L, GA3 0.25 mg/L, MES
    (Morpholino ethanesulfonic acid) 3.9 g/L, and pH 5.4.
    The explants containing the target tissue were immersed into Agrobacterium suspension and incubated for 1-2 hours. The Agrobacteriufn suspension was poured off, and the treated explants were placed onto a f lter paper inside co-cultivation plates. The adaxial side of the explants was kept in contact with the filter paper. The co-cultivation solid medium was composed of B5 salts (Sigma, O.OSX), BS vitamins (O.OSX), 40 mg/L
    acetosyringone, sucrose 20 g/L, BAP 2 mg/L, GA3 0.25 mg/L, MES 3.9 g/L, and pH
    5.4.
    The medium was solidified with O.S% purified agar (Sigma).
    The explants were co-cultivated with the Agrobacteriurn at 20-23° C for a period of 2-S days, under 16h . light/8h dark conditions. After co-cultivation, the explants were washed in sterile water containing 2S0 mg/L cefotaxime, primary and , secondary meristems were removed, and the explants were transferred to regeneration medium (i.e., REG-1 medium). During the regeneration process, any axillary shoots adjacent to the cotyledon were also removed to encourage growth from the area of the primary leaf base.
    R)JG-1 medium contained MS salts (1X), BS vitamins (1X), KN03 1 g/L, BAP 1 mg/L, ticarcillin 300 mg/L, cefotaxime 100 mg/L, glutamine 250 mg/L, asparagine SO
    mg/L, mannose 15-30 g/L, sucrose 0, 0.25, and 1 g/L, pH 5.6, and purified agar 10 g/L.
    Five explants were placed in each petri plate in an upright position, such that the epicotyl end of the explant was inserted into the medium. The plates were kept inside a plastic container and placed in a culture room at 22-2S° C, under an 18-20 hr light/4-6 hr dark cycle at GO-100 EKE m'a S'i. After 2 weeks on REG-I medium, explants were transferred to REG-2 medium, which contained MS salts ( 1 X) and BS vitamins ( 1 X), KNO3 1 g/L, BAP O.S mg/L, ticarcillin 300 mg/L, cefotaxime 100 mg/L, glutamine 250 mg/L, asparagine SO rng/L, mannose 1S g/L, and sucrose 1g/L. The media pH was maintained at 5.6, and the media was solidified with purified agar 10 g/L.

    At 4-6 weeks, the soybean cultures were transferred to REG-3 medium for continuing selection and shoot development. REG-3 medium contained MS salts (1X), BS vitamins (1X), KN03 1 g/L, BAP 0.2 mg/L, GA3 O.S mg/L, IBA 0.1 mg/L, ticarcillin 300 mg/L, cefotaxime 100 mg/L, glutamine 2S0 mg/L, asparagine SO mglL, mannose g/L, sucrose 1 glL, pH 5.6, and the medium was solidified with purified agar 10 g/L.
    Dead tissue was removed and explants with regenerating shoots were subcultured in fresh REG-3 medium every two weeks. Elongated shoots were continuously harvested from the cultures when they reached about 2-4 em in length. At that time, shoots were transferred to a rooting 111Cdllnl7, which contained MS salts (0.5X), BS
    Vitamins (O.SX), glutamine 2S0 mg/L, asparagine SO mg/L, KN03 1 g/L, cefotaxime 100 mg/L, ticarcillin 300 mg/L, sucrose 1 S g/L, IBA 0.5 mg/L, pH 5.6, and purif ed agar l OgIL.
    Itootc;d transgcnic ahoc~ts expressing a fluorescent protein gent (ZsGrccnl) were transferred to 2" pots which contained moistened Fafard germinating mix (Conrad Fafard Inc., MA, TJSA) and were kept covered with plastic cups for maintaining moisture for approximately 2 weeks. Plants were acclimatized at 27-29° C day temperature, 21° C
    night temperature, and a 16h photoperiod (20-40 ~E m a S-' light intensity).
    When new leaves began to emerge, plants were transferred to one-gallon pots which contained a soil mixture composed of SO-SS% composted pine bark, 40-45% Peat, S-IO% Perlite (Sungrow Horticultural Supply, Pine Bluff, Arkansas). Acclimatized soybean plants were grown in the greenhouse at 27-29° C day temp, 21° C night temp, 400-600 ~cE m a S-1 light intensity, 70-9S% relative humidity, and a 16 hr photoperiod. The plants were fertilized with osmocote (Scotts-Sierra Horticultural Products Company, Ohio;
    17-6-12) twice (S-8 g/gallon soil) during the growth period. Transformation was confirmed by Taqman analysis for the presence of the fluorescent protein gene as well as the PMI gene in the leaves of the greenhouse grown plants. Expression of the fluorescent protein gene in the transformed soybean tissue was also confirmed by visualizing the expression using a fluorescent microscope.
    Six transgenic plants developed using the gene construct pNOV214S were confirmed by Southern blot analyses. Progeny analysis of one event for either the PMI
    gene or the ZsGreenl gene.revealed one integration site of the T-DNA into the genome of the transformed soybean, and the progeny segregated in a 3:1 ratio in the generation.
    Table 1. Transformed shoots expressing fluorescent protein gene (Zsgreenl) Expt No. Gene construct Transformed Percent tr.
    shoots _ shoots/explant 75 NOV2145 _ 11 Soybean seeds (Var. S42 H1) were surface sterilized and explants were prepared as described in Example 2.
    Agrobacteriunt strain (LBA 4404) carrying the plasmid pNOV2147 was prepared as described in Example 1. The final bacterial concentration was adjusted to OD 660 =
    0.60 with a co-cultivation liquid medium. The conditions for explant preparation, Agrobacteriu~n inoculation, and co-cultivation were the same as those described in Example 2.
    Following three days of co-cultivation in a solid co-cultivation medium, excessive Agrobacteriurn was washed off, primary and secondary rneristems were removed, and the explants were transferred to REG-1 medium. They were cultured at 28-30°
    C in I6h light and 8h dark conditions. After 2 weeks on REG-1 medium, the cultures were transferred to ItEG-2 medium. During this regeneration process, only shoots arising from the base of a primary leaf were kept. At about the 4th week, the shoot cultures were transferred to REG-3 medium. They were then transferred to fresh REG-3 medium every 10-14 days.
    As in REG-I and REG-2 medium, only the new shoots arising from the base of a primary leaf were kept while the rest of the shoots were removed. When elongated shoots reached about 2-4 cm in length, they were separated from the rest of the shoot cultures and transferred to rooting medium.
    Five transgenic shoots out of 35 explants were identified as expressing the cyano fluorescent protein gene (Table 2).

    Table 2. Transformed shoots expressing the cyano fluorescent protein gene Experiment Gene constructTransformed % transformed shoots No.

    shoots/cxytants 92 pNOV2147 5/35 14 Mannose treatment during co-cultivation The gene construct used in this example was pNOV2145 (which comprises ZsGreenl and PMI genes, as described in Example 1). The procedures for preparing the explants, Agrobacteria suspensions, and inoculation of explants with bacterial suspensions were carried out as described in Example 2. The final bacterial concentration was adjusted to OD ~~o = 0.55 or 0.85.
    Following the inoculation step, explants were transferred to a co-cultivation imcdium containing either 20 g/L sucrose or 15 g/L mannose and were kept at 20-23° C
    under 16h light and 8h dark conditions.
    After 3-5 days of co-cultivation, expression of the fluorescent protein gene was visualized using a fluorescent microscope. Explants that were inoculated with ~Igrobueteriu~n in a mannose-containing co-cultivation medium showed at least two-fold the number of fluorescent spots compared to those co-cultivated in a sucrose-containing co-cultivation medium. Subsequent shoot regeneration and selection steps were followed as those described in Example 2.
    A significant increase in the production of transformed shoots was observed in the experiments where mannose was included in the co-cultivation medium (Table 3).
    Five transformed shoots from co-cultivation medium that included mannose were rooted and transferred to soil. Subsequent analysis by Taqman as well as Southern blot confirmed the integration of the transgenes. Transgene expression in the TI progeny confirmed the gennline transmission of the transgenes.

    Table 3. Transformed shoots expressing ZsGreenl fluorescent protein gene where explants and Agrobacteria were co-cultivated in mannose or sucrose Experiment Gene constructCo-culture Transformed No, in shoots/explantsTransformation mannose/sucrose 87 pNOV2145 Sucrose 0/60 0 Mannose 6/80 7.5 102 pNOV2145 Sucrose 1/20 5 Mannose 8140 20 In this example, Agrobacterium EHA101 comprising the plasmid pNOV2105 (SMAS-PMI SMAS-GUS, as described in Example 1) was used in soybean transformation. The preparation of the explants, Agrobacteria suspension, and inoculation of cxplants with Agrobacteria were the same as those described in Example 2.
    The final bacterial concentration was adjusted to OD 660 = 0.45 or 0.6.
    Following Agrobacteriurn inoculation, explants were transferred to a co-cultivation medium containing either 20 g/L sucrose or I S g/L mannose. Co-cultivation was carried out at 20-23° C under a 16h light and 8h dark conditions.
    Following 3-5 days of co-cultivation, GUS gene expression was visualized using a histochemical gus assay.
    Explants co-cultivated in mannose-containing co-cultivation medium showed at least two-fold the number of GUS spots compared to those co-cultivated in sucrose-containing co-cultivation medium. Shoot regeneration and selection were carried out as described in Example 2. A significant increase in the production of transformed shoots was observed in the experiment in which mannose was added into the co-cultivation medium.
    (Table 4).

    Table 4. Transformed shoots expressing GUS gene Experiment Gene constructCo-cultivationTransformed in No, mannose/sucroseshoots/explantTransformation 63 pNOV210S sucrose S/60 8 81 pNOV210S Sucrose 2130 7 Mannose S/30 17 In this example, Agrobacte~ium EHA101 comprising the plasmid pBSC11234 (FIG. S) was used in ~ soybean transformation. The components and sequence of pBSC11234 are set forth in SEQ 1D IN0:3. pBSC11234 comprises a CMP-PMI : beta conglycinin-galactosidase gene construct. The preparation of the explants, Agrobacteria suspension, and inoculation of explants with Agrobacteria were the same as those described in Example 2. The final bacterial concentration was adjusted to OD
    X60 = 0.6.
    The co-cultivation liquid medium contained Bs salts (0.1X), Bs vitamins (1X), acetosyringone 80 mg/L, sucrose 20 g/L, BAP 2 mglL, GA3 0.25 mg/L, MES 3.9 g/L, and pI-i 5.4. Solid co-cultivation medium was prepared by incorporating 5 g/L
    purified agar to the liquid co-cultivation medium. .
    Following Agrobacterium inoculation, explants were transferred to a solid co-cultivation medium and cultured at 20-24° C under 16h light and 8h dark conditions.
    Following 3-S days of co-cultivation, primary and secondary shoot meristems were removed and discarded, and the resulting explants were transferred to REG-4 medium, which contained Bs salts (1X), Bs Vitamins (1X), BAP 1 mg/L, glutamine SO
    mg/L, asparagine SO mg/L, cefotaxime 100 mg/L, ticarcillin 300 mg/L, mannose 1S-20 g/L, sucrose 0, 0.25, or 1 g/L, purified agar 10 g/L, and pH at 5.6. After a period of 5-7 days, any shoot grown from the axillary meristem close to the cotyledon was removed, and the explants were transferred to REG-S medium, which contained Bs salts (1X), Bs Vitamins '(1X), BAP O.S mg/L, glutamine SO mg/L, asparagine SO mg/L, cefotaxime 100 mg/L, ticarcillin 300 mg/L, mannose 1 S g/L, sucrose 1 g/L, purified agar 10 g/L, and pH at 5.6.

    At four weeks, explants were transferred to REG-6 medium for elongation of shoots.
    REG-6 medium contained MS salts (1X), MS Vitamins (1X) (MS vitamin composition:
    inositol 100 mg/L, nicotinic acid 0.5 mglL, pyridoxine HCl 0.5 mg/L, thiamine HCl 0.1 mglL, glycine 2 mg/L), myo-inositol 200 mg/L, BAP 0.2 mg/L, zeatin riboside 0.5 mg/L, IBA 0.1 mg/L, GA3 1 mg/L, glutamine 50 mg/L, asparagine 50 mg/L, ticarcillin n~b/L, 11°1a1717U5~ 15 g/L, SLtCI'osC 5 g/L, silver nitra tc 0.8 mg/L, purified agar 10 g/L, and pH 5.6. Explants were transferred to fresh REG-6 medium every two weeks.
    Elongated shoots (2-4 em long) were removed and rooted in rooting medium and transferred to soil.
    The rooting medium contained MS salts (1X), BS Vitamins (1X), glutamine 100 mg/L, asparagine 100 mg/L, IBA 0.7 mg/L, timentin 100 mg/L, and sucrose 15 g/L.
    Taqman analysis conf need the presence of the transgenes (alpha galactosidase and phosphomannose isomerase) in leaf samples from two events.

    In this example, Agrobacterium EHA101 comprising the plasmid pBSC11369 (FIG. 6) was used in soybean transformation. The components and sequence of pBSC11369 are set forth in SEQ ID N0:4. pBSC11369 comprises a CMP-HPT: CMP-ZsGreenl gene construct. The preparation of the explants, Agrobacteria suspension, and inoculation of cxplants with Agrobactcria were the same as those described in Example 2.
    The final bacterial concentration was adjusted to OD 66n = 0.6. The co-cultivation liquid medium contained BS salts (0.1X), BS vitamins (1X), acetosyringone 80 mg/L, sucrose 20 g/L, BAP 2 mg/L, GA3 0.25 mg/L, MES 3.9 g/L, and pH 5.4. Solid co-cultivation medium was prepared by incorporating 5 g/L purified agar to the liquid co-cultivation medium.
    following Agrobucteniiu~a inoculation, cxplants wore transferred to a solid.
    co-cultivation medium and cultured at 20-24° C under i 6h light and 8h dark conditions.
    Following 3-5 days of co-cultivation, explants were transferred to REG-7 medium after removing primary and secondary meristems from the explants in order to encourage shoot growth from the primary leaf base area. REG-7 medium contained BS salts (1X), BS Vitamins (1X), BAP 1 mg/L, glutamine 50 mg/L, asparagine 50 mg/L, cefotaxime 100 mg/L, ticarcillin 300 mg/L, sucrose 30 g/L, hygromycin 2-5 mg/L, purified agar 10 g/L, and pH 5,6. Explants were placed in an upright position such that the epicotyl end of the explant was inserted into the medium. After a period of 7-10 days, any shoots grown from the axillary mcristem close to the cotyledon were removed. Explants were transferred to fresh REG-8 medium, which contained BS salts (1X), BS Vitamins (1X), BAP 0.5 mg/L, glutamine 50 mg/L, asparagine SO mg/L, cefotaxime 100 mg/L, ticarcillin 300 mg/L, sucrose 30 glL, purified agar 10 g/L, and pH at 5.6. After another two weeks, explants were transferred to REG-9 medium and subcultured thereafter every two weeks.
    REG-9 medium contained MS salts (1X), MS Vitamins (1X), myo-inositol 200 mg/L, I3Af 0,2 mg/I,, actttin rifosidc 0.5 mg/1:,, 113A 0.1 mg/L, GAS 1 mg/L, glutaminc SO
    mg/L, asparagine 50 mg/L, silver nitrate 0.8 mg/L, ticarcillin 300 mg/L, sucrose 30 g/L, hygromycin 0.1-0.2 mg/L, purified agar 10 g/L, and pH 5.6. Elongated shoots (2-4 cm long) were removed, rooted in rooting medium, and then transferred to soil.
    The rooting medium contained MS salts (1X), BS Vitamins (1X), glutarnine 100 mg/L, asparagine '100 mg/L, IBA 0.7 mg/L, timentin 100 mg/L, and sucrose I S g/L. Taqman analysis confirmed the presence of the transgenes (HPT as well as ZsGreenl) in leaf samples obtained from five events. Expression of the ZsGreenl gene in plant parts was confirmed by visualization under a fluorescent microscope.
    All publications, patents, and patent applications cited herein are incorporated by reference. While in the foregoing specification this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.

    Syngenta SEQUENC E LISTING

    <110>
    Syngenta Participations AG

    <120>
    METHOD
    OF TRANSFORMTNG
    SOYBEAN

    <130>

    USPS

    <160>

    <170>
    Patentln version 3.2 <210>

    <211>

    <212>
    DNA

    <213>
    Artificial <220>

    <223>
    pNOV2145 <400>

    gatccaccggtcgccaccatggeccagtccaagcacggcctgaccaaggagatgaccatg60 aagtaccgcatggagggctgcgtggacggccacaagttcgtgatcaccggcgagggcatc120 ggctaccccttcaagggcaagcaggccatcaacctgtgcgtggtggagggcggccccttg180 cccttcgccgaggacatcttgtccgccgccttcatgtacggcaaccgcgtgttcaccgag240 tacccccaggacatcgtcgactacttcaagaactcctgccccgccggctacacctgggac300 cgetcettcctgttegaggacggcgccgtgtgcatctgcaacgcegaeatcaccgtgagc360 gtggaggagaactgcatgtaccacgagtccaagttctacggcgtgaacttccccgccgac420 ggccccgtgatgaagaagatgaccgacaactgggagccctcctgcgagaagatcatcccc480 gtgcccaagcagggcatcttgaagggcgacgtgagcatgtacctgctgctgaaggacggt540 ggccgcttgcgctgccagttcgacaccgtgtacaaggccaagtccgtgccccgcaagatg600 cccgactggcacttcatccagcacaagctgacccgegaggaccgcagcgacgccaagaac660 cagaagtggcacctgaccgagcacgccatcgcctccggctccgccttgccctgagcggcc720 ctctagatccccgaatttccccgategttcaaacatttggcaataaagtttcttaagatt780 gaatcctgttgccggtettgcgatgattatcatataatttctgttgaattacgttaagea840 tgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagt900 eccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataa960 attatcgcgcgcggtgtcatctatgttactagatcgggaattgggtaccgaattcactgg1020 ccgtcgttttacaacgt gactgggaaaaccctggcgttacccaacttaatcgccttg1080 cgt cagcacatccccctttegecagctggcgtaatagcgaagaggcccgcaccgatcgccctt1140 cccaacagttgcgcagc aatggcgaatggcgcctgatgcggtattttctccttacgc1200 ctg atctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccg1260 70094 syngenta catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga cgggcttgtc 1320 tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc atgtgtcaga 1380 ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg cctcgtgata cgcctatttt 1440 tataggttaa tgtcatgata ataatggttt cttagacgtc aggtggcact tttcggggaa 1500 atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca 1560 tgagacaata accctgataa atgcttcaat ggcgcgccgg taccagcttg catgcctgca 1620 ggtcgactct agaggatcct ggcagacaaa gtggcagaca tactgtccca caaatgaaga 1680 tggaatctgt aaaagaaaac gcgtgaaata atgcgtctga caaaggttag gtcggctgcc 1740 tttaatcaat accaaagtgg tccctaccac gatggaaaaa ctgtgcagtc ggtttggctt 1800 tttctgacga acaaataaga ttcgtggccg acaggtgggg gtccaccatg tgaaggcatc 1860 ttcagactcc aataatggag caatgacgta agggcttacg aaataagtaa gggtagtttg 1920 ggaaatgtcc actcacccgt cagtctataa atacttagcc cctccctcat tgttaaggga 1980 gcaaaatctc agagagatag tcctagagag agaaagagag caagtagcct agaagtagga 2040 tccccgatca tgcaaaaact cattaactca gtgcaaaact atgcctgggg cagcaaaacg 2 100 gcgttgactg aactttatgg tatggaaaat ccgtccagcc agccgatggc cgagctgtgg 2160 atgggcgcac atccgaaaag cagttcacga gtgcagaatg ccgccggaga tatcgtttca 2220 ctgcgtgatg tgattgagag tgataaatcg actctgctcg gagaggccgt tgccaaacgc 2280 tttggcgaac tgcctttcct gttcaaagta ttatgcgcag cacagccact ctccattcag 2340 gttcatccaa acaaacacaa ttctgaaatc ggttttgcca aagaaaatgc cgcaggtatc 2400 ccgatggatg ccgccgagcg taactataaa gatcctaacc acaagccgga gctggttttt 2460 gcgctgacgc ctttccttgc gatgaacgcg tttcgtgaat tttccgagat tgtctcccta 2520 ctccagccgg tcgcaggtgc acatccggcg attgctcact ttttacaaca gcctgatgcc 2580 gaacgtttaa gcgaactgtt cgccagcctg ttgaatatgc agggtgaaga aaaatcccgc 2640 gcgctggcga ttttaaaatc ggccctcgat agccagcagg gtgaaccgtg gcaaacgatt 2700 cgtttaattt ctgaatttta cccggaagac agcggtctgt tctccccgct attgctgaat 2760 gtggtgaaat tgaaccctgg cgaagcgatg ttcctgttcg ctgaaacacc gcacgcttac 2820 ctgcaaggcg tggcgctgga agtgatggca aactccgata acgtgctgcg tgcgggtctg 2880 acgcctaaat acattgatat tccggaactg gttgccaatg tgaaattcga agccaaaccg 2940 gctaaccagt tgttgaccca gccggtgaaa caaggtgcag aactggactt cccgattcca 3000 gtggatgatt ttgccttctc gctgcatgac cttagtgata aagaaaccac cattagccag 3060 cagagtgccg ccattttgtt ctgcgtcgaa ggcgatgcaa cgttgtggaa aggttctcag 3120 cagttacagc ttaaaccggg tgaatcagcg tttattgccg ccaacgaatc accggtgact 3180 70094 syngenta gtcaaaggccacggccgtttagcgcgtgtttacaacaagctgtaagagcttactgaaaaa3240 attaaeatctcttgctaagctgggagctctagatccccgaatttccccgatcgttcaaac3300 atttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcata3360 taatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttattt3420 atgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaac3480 aaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagat3540 cgggaattgggtaccatgcccgggcggccagcatggccgtatccgcaatgtgttattaag3600 ttgt ctaagcgtcaatttgtttacaccacaatatatcctgccaccagccagccaacagct3660 ccccgaccggcagctcggcacaaaatcaccactcgatacaggcagcccatcagaattaat3720 tctcatgtttgacagcttatcatcgactgcacggtgcaccaatgcttctggcgtcaggca3780 gccatcggaagctgtggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgct3840 caaggcgcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaa3900 atattctgaaatgagctgttgacaattaatcatccggctcgtataatgtgtggaattgtg396b agcggataacaatttcacaeaggaaacagaccatgagggaagcgttgatcgccgaagtat4020 cgactcaactatcagaggtagttggcgtcatcgagcgccatctcgaaccgacgttgctgg4080 ccgtacatttgtacggctccgcagtggatggcggcctgaagccacacagtgatattgatt4140 tgctggttacggtgaccgtaaggcttgatgaaacaacgcggcgagctttgatcaacgacc4200 ttttggaaacttcggcttcccctggagagagcgagattctccgcgctgtagaagtcacca4260 ttgt-tgtgcacgacgacatcattccgtggcgttatccagctaagcgcgaactgcaatttg4320 gagaatggcagcgcaatgacattcttgcaggtatcttcgagccagccacgatcgacattg4380 atctggctatcttgctgacaaaagcaagagaacatagcgttgccttggtaggtccagcgg4440 cggaggaactctttgatccggttcctgaacaggatctatttgaggcgctaaatgaaacct4500 taacgctatggaactcgccgcccgactgggctggcgatgagcgaaatgtagtgcttacgt4560 tgtcccgcatttggtacagcgcagtaaccggcaaaatcgcgccgaaggatgtcgctgccg4620 actgggcaatggagcgcctgccggcccagtatcagcccgtcatacttgaagctaggcagg4680 cttatcttggacaagaagatcgcttggcctcgcgcgcagatcagttggaagaatttgttc4740 actacg-tgaaaggcgagatcaccaaagtagtcggcaaataaagctctagtggatctccgt4800 accccegggggatctggctcgcggcggacgcacgacgccggggcgagaccataggcgatc4860 tcctaaatcaatagtagctgtaacctcgaagcgtttcacttgtaacaacgattgagaatt4920 tttgtcataaaattgaaatacttggttcgcatttttgtcatccgcggtcagccgGa~ttc4980 tgacgaactgcccatttagctggagatgattgtacatccttcacgtgaaaattt~tc~ag5Q40 Syngenta cgctgtgaacaagggttcagattttagattgaaaggtgagccgttgaaacacgttcttct5100 tgtcgatgacgacgtcgctatgcggcatcttattattgaataccttacgatccacgcctt5160 caaagtgaccgcggtagccgacagcacccagttcacaagagtactctcttccgcgacggt5220 cgatgtcgtggttgttgatctaaatttaggtcgtgaagatgggctcgagatcgttcgtaa5280 tctggcggcaaagtctgatattccaatcataattatcagtggcgaccgccttgaggagac5340 ggataaagttgttgcactcgagctaggagcaagtgattttatcgctaagccgttcagtat5400 cagagagtttctagcacgeattcgggttgccttgcgcgtgcgccccaacgttgtccgctc5460 caaagaecgacggtctttttgttttactgactggacacttaatctcaggcaacgtcgctt5520 gatgtccgaagctggcggtgaggtgaaacttacggcaggtgagttcaatcttctcctcgc5580 gtttttagagaaaccccgcgacgttctatcgcgcgagcaacttctcattgccagtcgagt5640 acgcgacgaggaggtttatgacaggagtatagatgttctcattttgaggctgcgccgcaa5700 acttgaggcagatccgtcaagccctcaactgataaaaacagcaagaggtgccggttattt5760 ctttgacgcggacgtgcaggtttcgcacggggggacgatggcagcctgagccaattccca5820 gatccccgaggaatcggcgtgagcggtcgcaaaccatccggcccggtacaaatcggcgcg5880 gcgctgggtgatgacctggtggagaagttgaaggccgcgcaggccgcccagcggcaacgc5940 atcgaggcagaagcacgccccggtgaatcgtggcaagcggccgctgatcgaatccgcaaa6000 gaatcccggcaaccgccggcagccggtgcgccgtcgattaggaagccgcccaagggcgac6060 gagcaaccagattttttcgttccgatgctctatgacgtgggcacccgcgatagtcgcagc6120 atcatggacgtggccgttttccgtctgtcgaagcgtgaccgacgagctggcgaggtgatc6180 cgctacgagcttccagacgggcacgtagaggtttccgcagggccggccggcatggccagt6240 gtgtgggattacgacctggtactgatggcggtttcccatctaaccgaatccatgaaccga6300 taccgggaagggaagggagacaagcccggccgcgtgttccgtccacacgttgcggacgta6360 ctcaagttctgccggcgagccgatggcggaaagcagaaagacgacctggtagaaacctgc6420 attcggttaaacaccacgcacgttgccatgcagcgtacgaagaaggccaagaacggccgc6480 ctggtgacggtatccgagggtgaagccttgattagccgctacaagatcgtaaagagcgaa6540 accgggcggccggagtacatcgagatcgagctagctgattggatgtaccgcgagatcaca6600 gaaggcaagaacccggacgtgctgacggttcaccccgattactttttgatcgatcccggc6660 atcggccgttttctctaccgcctggcacgccgcgccgcaggcaaggcagaagccagatgg6720 ttgttcaagacgatctacgaacgcagtggcagcgccggagagttcaagaagttctgtttc6780 accgtgcgcaagctgatcgggtcaaatgacctgccggagtacgatttgaaggaggaggcg6840 gggcaggctggcccgatcctagtcatgcgctaccgcaacctgatcgagggcgaagcatcc6900 gccggttcctaatgtacggagcagatgctagggcaaattgccctagcaggggaaaaaggt6960 70094 syngenta cgaaaaggtc tctttcctgt ggatagcacg tacattggga acccaaagcc gtacattggg 7020 aaccggaacc cgtacattgg gaacccaaag ccgtacattg ggaaccggtc acacatgtaa 7080 gtgactgata taaaagagaa aaaaggcgat ttttccgcct aaaactcttt aaaacttatt 7140 aaaactctta aaacccgcct ggcctgtgca taactgtctg gccagcgcac agccgaagag 7200 ctgcaaaaag cgcctaccct tcggtcgctg cgctccctac gccccgccgc ttcgcgtcgg 7260 cctatcgcgg ccgctggccg ctcaaaaatg gctggcctac ggccaggcaa tctaccaggg 7320 cgcggacaag ccgcg~cgtc gccactcgac cgccggcgct gaggtctgcc tcgtgaagaa 7380 ggtgttgctg actcatacca ggcctgaatc gccccatcat ccagccagaa agtgagggag 7440 ccacggttga tgagagcttt gttgtaggtg gaccagttgg tgattttgaa cttttgcttt 7500 gccacggaac ggtctgcgtt gtcgggaaga tgcgtgatct gatccttcaa ctcagcaaaa 7560 gttcgattta ttcaacaaag ccgccgtccc gtcaagtcag cgtaatgctc tgccagtgtt 7620 acaaccaatt aaccaattct gattagaaaa actcatcgag catcaaatga aactgcaatt 7680 tattcatatc aggattatca ataccatatt tttgaaaaag ccgtttctgt aatgaaggag 7740 aaaactcacc gaggcagttc cataggatgg caagatcctg gtatcggtct gcgattccga 7800 ctcgtccaac atcaatacaa cctattaatt tcccctcgtc aaaaataagg ttatcaagtg 7860 agaaatcacc atgagtgacg actgaat~cg gtgagaatgg caaaagctct gcattaatga 7920 atcggccaac gcgcggggag aggcggtttg cgtattgggc gctcttccgc ttcctcgctc 7980 actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg 8040 gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc 8100 cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc 8160 ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga 8220 ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc 8280 ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat 8340 agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg 8400 ca~gaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 8460 aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 8520 gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 8580 agaagaacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 8640 ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag 8700 cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 8760 tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa 8820 Page S

    70094 Syngenta aggatcttcacctagatccttttgatccggaattaattcctgtggttggcatgcacatac8880 aaatggacgaacggataaacettttcacgcccttttaaatatccgattattctaataaac8940 gctcttttctcttaggtttacccgccaatatatcctgtcaaacactgatagtttaaactg9000 aaggcgggaaacgacaatctgatcatgagcggagaattaagggagtcacgttatgacccc9060 cgccgatgacgcgggacaagccgttttacgtttggaactgacagaaccgcaacgctgcag9120 gaattggccgcagcggccatttaaatcaattgggcgcgtacgtagcactagtgcgcgatc9180 gcttaattaagcggcgcgcctaaagcttctggcagacaaagtggcagacatactgtccca9240 caaatgaagatggaatctgtaaaagaaaacgcgtgaaataatgcgtctgacaaaggttag9300 gtcggctgcctttaatcaataccaaagtggtccctaccacgatggaaaaactgtgcagtc9360 ggtttggctttttctgacgaacaaataagattcgtggccgacaggtgggggtccaccatg9420 tgaaggcatcttcagactccaataatggagcaatgacgtaagggcttacgaaataagtaa9480 gggtagtttgggaaatgtccactcacccgtcagtctataaatacttagcccctccctcat9540 tgttaagggagcaag <210>

    <211>

    <212>
    DNA

    <213>
    Artificial <220>

    <223>
    pNOV2147 <400>

    ggatccccgatcatgcaaaaactcattaactcagtgcaaaactatgcctggggcagcaaa60 acggcgttgactgaactttatggtatggaaaatccgtccagecagccgatggccgagctg120 tggatgggcgcacatccgaaaagcagttcaegagtgcagaatgccgccggagatatcgtt180 tcactgcgtgatgtgattgagagtgataaatcgactctgctcggagaggccgttgccaaa240 cgctttggcgaactgcctttcctgttcaaagtattatgcgcagcacagccactctccatt300 caggttcatccaaacaaacacaattctgaaatcggttttgccaaagaaaatgccgcaggt360 atccegatggatgccgecgagcgtaactataaagatcctaaceacaagccggagctggtt420 tttgcgctgacgcctttccttgcgatgaacgcgtttcgtgaattttccgagattgtctcc480 ctactccagccggtcgcaggtgcacatecggcgattgctcactttttacaacagcctgat540 gccgaacgtttaagcgaactgttcgccagcctgttgaatatgcagggtgaagaaaaatcc600 cgcgcgctggcgattttaaaatcggccctcgatagccagcagggtgaaccgtggeaaacg660 attcgtttaatttctgaattttacccggaagacagcggtctgttctccccgctattgctg720 aatgtggtgaaattgaaccctggcgaagcgatgttcctgttcgctgaaacaccgcacgct780 tacctgcaaggcgtggcgctggaagtgatggcaaactccgataacgtgctgcgtgcgggt840 page 6 70094 Syngenta ctgacgccta aatacattga tattccggaa ctggttgcca atgtgaaatt cgaagccaaa 900 ccggc~fiaacc agttgttgac ccagccggtg aaacaaggtg cagaactgga cttcccgatt 960 ccagtg~gatg attttgcctt ctcgctgcat gaccttagtg ataaagaaac caccattagc 1020 cagcag~agtg ccgccatttt gttctgcgtc gaaggcgatg caacgttgtg gaaaggttct 1080 cagcagttac agcttaaacc gggtgaatca gcgtttattg ccgccaacga atcaccggtg 1140 actgtcaaag gccacggccg tttagcgcgt gtttacaaca agctgtaaga gcttactgaa 1200 aaaattaaca tctcttgcta agctgggagc tctagatccc cgaatttccc cgatcgttca 1260 aacatttggc aataaagttt cttaagattg aatcctgttg ccggtcttgc gatgattatc 1320 atataatttc tgttgaatta cgttaagcat gtaataatta acatgtaatg catgacgtta 1380 tttatgagat gggtttttat gattagagtc ccgcaattat acatttaata cgcgatagaa 1440 aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc tatgttacta 1500 gatcgggaat tgggtaccat gcccgggcgg ccagcatggc cgtatccgca atgtgttatt 1560 aagttgrtcta agcgtcaatt tgtttacacc acaatatatc ctgccaccag ccagccaaca 1620 gctccccgac Cggcagctcg gcaeaaaatc accactcgat acaggcagcc catcagaatt 1680 aattctcatg tttgacagct tatcatcgac tgcacggtgc accaatgctt ctggcgtcag 1740 gcagccatcg gaagctgtgg tatggctgtg caggtcgtaa atcactgcat aattcgtgtc 1800 gctcaaggcg cactcccgtt ctggataatg ttttttgcgc cgacatcata acggttctgg 1860 caaatattct gaaatgagct gttgacaatt aatcatccgg ctcgtataat gtgtggaatt 1920 gtgagcggat aacaatttca cacaggaaac agaccatgag ggaagcgttg atcgccgaag 1980 tatcgactca actatcagag gtagttggcg tcatcgagcg ccatctcgaa ccgacgttgc 2040 tggccgtaca tttgtacggc tccgcagtgg atggcggcct gaagccacac agtgatattg 2100 atttgctggt tacggtgacc gtaaggcttg atgaaacaac gcggcgagct ttgatcaacg 2160 accttttgga aacttcggct tcccctggag agagcgagat tctccgcgct gtagaagtca 2220 ccattgttgt gcacgacgac atcattccgt ggcgttatcc agctaagcgc gaactgcaat 2280 ttggagaatg gcagcgcaat gacattcttg caggtatctt cgagccagcc acgatcgaca 2340 ttgatctggc tatcttgctg acaaaagcaa gagaacatag cgttgccttg gtaggtccag 2400 cggcggagga actctttgat ccggttcctg aacaggatct atttgaggcg ctaaatgaaa 2460 ccttaacgct atggaactcg ccgcccgact gggctggcga tgagcgaaat gtagtgctta 2520 cgttgtcccg catttggtac agcgcagtaa ccggcaaaat cgcgccgaag gatgtcgctg 2580 ccgactgggc aatggagcgc ctgccggccc agtatcagcc cgtcatactt gaagctaggc 2640 aggcttatct tggacaagaa gatcgcttgg cctcgcgcgc agatcagttg gaagaatttg 2700 70094 Syngenta ttcactacgtgaaaggcgagatcaccaaagtagtcggcaaataaagctctagtggatctc2760 cgtacccccgggggatctggctcgcggcggacgcacgacgccggggcgagaccataggcg2820 atctcctaaatcaatagtagctgtaacctcgaagcgtttcacttgtaacaacgattgaga2880 atttttgtcataaaattgaaatacttggttcgcatttttgtcatccgcggtcagccgcaa2940 ttctgacgaactgcccatttagctggagatgattgtacatccttcacgtgaaaatttctc3000 aagcgctgtgaacaagggttcagattttagattgaaaggtgagccgttgaaacacgttct3060 tcttgtcgatgacgacgtcgctatg~ggcatcttattattgaataccttacgatccacgc3120 cttcaaagtgaccgcggtagccgacagcacccagttcacaagagtactctcttccgcgac3180 ggtcgatgtcgtggttgttgatctaaatttaggtcgtgaagatgggctcgagatcgttcg3240 taatctggcggcaaagtctgatattccaatcataattatcagtggcgaccgccttgagga3300 gacggataaagttgttgcactcgagctaggagcaagtgattttatcgctaagccgttcag3360 tatcagagagtttctagcacgcattcgggttgccttgcgcgtgcgccccaacgttgtccg3420 ctccaaagaccgacggtctttttgttttactgactggacacttaatctcaggcaacgtcg3480 cttgatgtccgaagctggcggtgaggtgaaacttacggcaggtgagttcaatettctcct3540 cgcgtttttagagaaaccccgcgacgttctatcgcgcgagcaacttctcattgccagtcg3600 agtacgcgacgaggaggtttatgacaggagtatagatgttctcattttgaggctgcgccg3660 caaacttgaggcagatccgtcaagccctcaactgataaaaacagcaagaggtgccggtta3720 tttctttgacgcggacgtgcaggtttcgcacggggggacgatggcagcctgagccaattc3780 ccagatccccgaggaatcggcgtgagcggtcgcaaaccatccggcccggtacaaatcggc3840 gcggcgctgggtgatgacctggtggagaagttgaaggccgcgcaggccgcccagcggcaa3900 cgcatcgaggcagaagcacgccccggtgaatcgtggcaagcggccgctgatcgaatccgc3960 aaagaatcccggcaaccgccggcagccggtgcgccgtcgattaggaagccgcccaagggc4020 gacgagcaaccagattttttcgttccgatgctctatgacgtgggcacccgcgatagtcgc4080 agcatcatggacgtggccgttttccgtctgtcgaagcgtgaccgacgagctggcgaggtg4140 atccgctacgagcttccagacgggcacgtagaggtttccgcagggccggccggcatggcc4200 agtgtgtgggattacgacctggtactgatggcggtttcccatctaaccgaatccatgaac4260 cgataccgggaagggaagggagacaagcccggccgcgtgttccgtccacacgttgcggac4320 gtactcaagttctgccggcgagccgatggcggaaagcagaaagacgacctggtagaaacc4380 tgcattcggttaaacaccacgcacgttgccatgcagcgtacgaagaaggccaagaacggc4440 cgcctggtgacggtatccgagggtgaagccttgattagccgctacaagatcgtaaagagc4500 gaaaccgggcggccggagtacatcgagatcgagctagctgattggatgtaccgcgagatc4560 acagaaggcaagaacccggacgtgctgacggttcaccccgattactttttgatcgatccc4620 70094 syngenta ggcatcggcc gttttctcta ccgcctggca cgccgcgccg caggcaaggc agaagccaga 4680 tggttgttca agacgatcta cgaaegcagt ggcagcgccg gagagttcaa gaagttctgt 4740 ttcaccgtgc gcaagctgat cgggtcaaat gacctgccgg agtacgattt gaaggaggag 4800 gcggggcagg ctggcccgat cctagtcatg cgctaccgca acctgatcga gggcgaagca 4860 tccgccggtt cctaatgtac ggagcagatg ctagggcaaa ttgccctagc aggggaaaaa 4920 ggtcgaaaag gtctctttcc tgtggatagc acgtacattg ggaacccaaa gccgtacatt 4980 gggaaccgga acccgtacat tgggaaccca aagccgtaca ttgggaaccg gtcacacatg 5040 taagtgactg atataaaaga gaaaaaaggc gatttttccg cctaaaactc tttaaaactt 5100 attaaaactc ttaaaacccg cctggcctgt gcataactgt ctggccagcg cacagccgaa 5160 gagctgcaaa aagcgcctac ccttcggtcg ctgcgctccc tacgccccgc cgcttcgcgt 5220 cggcctatcg cggccgctgg ccgctcaaaa atggctggcc tacggccagg caatctacca 5280 gggcgcggac aagccgcgcc gtcgccactc gaccgccggc gctgaggtct gcctcgtgaa 5340 gaaggtgttg ctgactcata ccaggcctga atcgccccat catccagcca gaaagtgagg 5400 gagccacggt tgatgagagc tttgttgtag gtggaccagt tggtgatttt gaacttttgc 5460 tttgccacgg aacggtctgc gttgtcggga agatgcgtga tctgatcctt caactcagca 5520 aaagttcgat ttattcaaca aagccgccgt cccgtcaagt cagcgtaatg ctctgccagt 5580 gttacaacca attaaccaat tctgattaga aaaactcatc gagcatcaaa tgaaactgca 5640 atttattcat atcaggatta tcaataccat atttttgaaa aagccgtttc tgtaatgaag 5700 gagaaaactc accgaggcag ttccatagga tggcaagatc ctggtatcgg tctgcgattc 5760 cgactcgtcc aacatcaata caacctatta atttcccctc gtcaaaaata aggttatcaa 5820 gtgagaaatc accatgagtg acgactgaat ccggtgagaa tggcaaaagc tctgcattaa 5880 tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg 5940 ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag 6000 gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat gtgagcaaaa 6060 ggccagcaaa aggccaggaa ccgtaaaaag.gccgcgttgc tggcgttttt ccataggctc 6120 cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg aaacccgaca 6180 ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc tcctgttccg 6240 accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt ggcgctttct 6300 catagctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt 6360 gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag 6420 tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa caggattagc 6480 Syngenta agagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctac6540 actagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaaga6600 gttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgc6660 aagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacg6720 gggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatca6780 aaaaggatcttcacctagatccttttgatccggaattaattcctgtggttggcatgcaca6840 tacaaatggacgaacggataaaccttttcacgcccttttaaatatccgattattctaata6900 aacgctcttttctcttaggtttacccgccaatatatcctgtcaaacactgatagtttaaa6960 ctgaaggcgggaaacgacaatctgatcatgagcggagaattaagggagtcacgttatgac7020 ccccgccgatgacgcgggacaagccgttttacgtttggaactgacagaaccgcaacgctg7080 caggaattggccgcagcggccatttaaatcaattgggcgcgtacgtagcactagtgcgcg7140 atcgcttaattaagcggcgcgcctaaagcttctggcagacaaagtggcagacatactgtc7200 ccacaaatgaagatggaatctgtaaaagaaaacgcgtgaaataatgcgtctgacaaaggt7260 ~

    taggtcggctgcctttaatcaataccaaagtggtccctaccacgatggaaaaactgtgca7320 .

    gtcggtttggctttttctgacgaacaaataagattcgtggccgacaggtgggggtccacc7380 atgtgaaggcatcttcagactccaataatggagcaatgacgtaagggcttacgaaataag7440 taagggtagtttgggaaatgtccactcacccgtcagtctataaatacttagcccctccct7500 cattgttaagggagcaaggatccaccggtcgccaccatggccctgtccaacaagttcatc7560 ggcgacgacatgaagatgacctaccacatggacggctgcgtgaacggccactacttcacc7620 gtgaagggcgagggcagcggcaagccctacgagggcacccagacctccaccttcaaggtg7680 accatggccaacggcggccccctggccttctccttcgacatcctgtccaccgtgttcatg7740 tacggcaaccgctgcttcaccgcctaccccaccagcatgcccgactacttcaagcaggcc7800 ttccccgacggcatgtcctacgagagaaccttcacctacgaggacggcggcgtggccacc7860 gccagctgggagatcagcctgaagggcaactgcttcgagcacaagtccaccttccacggc7920 gtgaacttccccgccgacggccccgtgatggccaagaagaccaccggctgggacccctcc7980 ttcgagaagatgaccgtgtgcgacggcatcttgaagggcgacgtgaccgccttcctgatg8040 etgeagggcggeggcaactaeagatgceagttccacacctcctaeaagaeeaagaagecc8100 gtgaccatgccccccaaccacgtggtggagcaccgcatcgccagaaccgacctggacaag8160 ggcggcaacagcgtgcagctgaccgagcacgccgtggcccacatcacctccgtggtgccc8220 ttctgagagctctagatccccgaatttccccgatcgttcaaacatttggcaataaagttt8280 cttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaatta8340 cgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttat8400 70094 syngenta gattagagtc ccgcaattat acatttaata cgcgatagaa aacaaaatat agcgcgcaaa 8460 ctaggataaa ttatcgcgcg cggtgtcatc tatgttacta gatcgggaat tgggtaccga 8520 attcactggc cgtcgtttta caacgtcgtg actgggaaaa ccctggcgtt acccaactta 8580 atcgccttgc agcacatccc cctttcgcca gctggcgtaa tagcgaagag gcccgcaccg 8640 atcgcccttc ccaacagttg cgcagcctga atggcgaatg gcgcctgatg cggtattttc 8700 tccttacgca tctgtgcggt atttcacacc gcatatggtg cactctcagt acaatctgct 8760 ctgatgccgc atagttaagc cagccccgac acccgccaac acccgctgac gcgccctgac 8820 gggcttgtct gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca 8880 tgtgtcagag gttttcaccg tcatcaccga aacgcgcgag acgaaagggc ctcgtgatac 8940 gcctattttt ataggttaat gtcatgataa taatggtttc ttagacgtca ggtggcactt 9000 ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat tcaaatatgt 9060 atccgctcat gagacaataa ccctgataaa tgcttcaatg gcgcgccggt accagcttgc 9120 atgcctgcag gtcgactcta gaggatcctg gcagacaaag tggcagacat actgtcccac 9180 aaatgaagat ggaatctgta aaagaaaacg cgtgaaataa tgcgtctgac aaaggttagg 9240 tcggctgcct ttaatcaata ccaaagtggt ccctaccacg atggaaaaac tgtgcagtcg 9300 gtttggcttt ttctgacgaa caaataagat tcgtggccga caggtggggg tccaccatgt 9360 gaaggcatct tcagactcca ataatggagc aatgacgtaa gggcttacga aataagtaag 9420 ggtagtttgg gaaatgtcca ctcacccgtc agtctataaa tacttagccc ctccctcatt 9480 gttaagggag caaaatctca gagagatagt cctagagaga gaaagagagc aagtagccta 9540 gaagta <210> 3 <211> 10604 <212> DNA
    <213> Artificial <220>

    <223>
    pBSC11234 <400>

    cgcgcctaaagcttgcatgcctgcaggtcgactctagaggatcctggcagacaaagtggc60 agacatactgtcccacaaatgaagatggaatctgtaaaagaaaacgcgtgaaataatgcg120 tctgacaaaggttaggtcggctgcctttaatcaataccaaagtggtccctaccacgatgg180 aaaaactgtgcagtcggtttggctttttctgacgaacaaataagattcgtggccgacagg240 tgggggtccaccatgtgaaggcatcttcagactccaataatggagcaatgacgtaagggc300 ttacgaaataagtaagggtagtttgggaaatgtccactcacccgtcagtctataaatact360 to cccctcc ctcatt tta a 70094 syngenta g g gggagcaaa atctcagaga gatagtccta gagagagaaa 420 gagagcaagt agcctagaag taggatcccc gatcatgcaa aaactcatta actcagtgca 480 aaactatgcc tggggcagca aaacggcgtt gactgaactt tatggtatgg aaaatccgtc 540 cagccagccg atggccgagc tgtggatggg cgcacatccg aaaagcagtt cacgagtgca 600 gaatgccgcc ggagatatcg tttcactgcg tgatgtgatt gagagtgata aatcgactct 660 gctcggagag gccgttgcca aacgctttgg cgaactgcct ttcctgttca aagtattatg 720 cgcagcacag ccactctcca ttcaggttca tccaaacaaa cacaattctg aaatcggttt 780 tgccaaagaa aatgccgcag gtatcccgat ggatgccgcc gagcgtaact ataaagatcc 840 taaccacaag ccggagctgg tttttgcgct gacgcctttc cttgcgatga acgcgtttcg 900 tgaattttcc gagattgtct ccctactcca gccggtcgca ggtgcacatc cggcgattgc 960 tcacttttta caacagcctg atgccgaacg tttaagcgaa ctgttcgcca gcctgttgaa 1020 tatgcagggt gaagaaaaat cccgcgcgct ggcgatttta aaatcggccc tcgatagcca 1080 gcagggtgaa ccgtggcaaa cgattcgttt aatttctgaa ttttacccgg aagacagcgg 1140 tctgttctcc ccgctattgc tgaatgtggt gaaattgaac cctggcgaag cgatgttcct 1200 gttcgctgaa acaccgcacg cttacctgca aggcgtggcg ctggaagtga tggcaaactc 1260 cgataacgtg ctgcgtgcgg gtctgacgcc taaatacatt gatattccgg aactggttgc 1320 caatgtgaaa ttcgaagcca aaccggctaa ccagttgttg acccagccgg tgaaacaagg 1380 tgcagaactg gacttcccga ttccagtgga tgattttgcc ttctcgctgc atgaccttag 1440 tgataaagaa accaccatta gccagcagag tgccgccatt ttgttctgcg tcgaaggcga 1500 tgcaacgttg tggaaaggtt ctcagcagtt acagcttaaa ccgggtgaat cagcgtttat 1560 tgccgccaac gaatcaccgg tgactgtcaa aggccacggc cgtttagcgc gtgtttacaa 1620 caagctgtaa gagcttactg aaaaaattaa catctcttgc taagctggga gctctagatc 1680 cccgaatttc cccgatcgtt caaacatttg gcaataaagt ttcttaagat tgaatcctgt 1740 tgccggtctt gcgatgatta tcatataatt tctgttgaat tacgttaagc atgtaataat 1800 taacatgtaa tgcatgacgt tatttatgag atgggttttt atgattagag tcccgcaatt 1860 atacatttaa tacgcgatag aaaacaaaat atagcgcgca aactaggata aattatcgcg 1920 cgcggtgtca tctatgttac tagatcggga attgggtacc atgcccgggc ggccagcatg 1980 gccgtatccg caatgtgtta ttaagttgtc taagcgtcaa tttgtttaca ccacaatata 2040 tcctgccacc agccagccaa cagctccccg accggcagct cggcacaaaa tcaccactcg 2100 atacaggcag cccatcagaa ttaattctca tgtttgacag cttatcatcg actgcacggt 2160 gcaccaatgc ttctggcgtc aggcagccat cggaagctgt ggtatggctg tgcaggtcgt 2220 aaatcactgc ataattcgtg tcgctcaagg cgcactcccg ttctggataa tgttttttgc 2280 70094 syngenta gccgacatca taacggttct ggcaaatatt ctgaaatgag ctgttgacaa ttaatcatcc 2340 ggctcgtata atgtgtggaa ttgtgagcgg ataacaattt cacacaggaa acagaccatg 2400 agggaagcgt tgatcgccga agtatcgact caactatcag aggtagttgg cgtcatcgag 2460 cgccatctcg aaccgacgtt gctggccgta catttgtacg gctccgcagt ggatggcggc 2520 ctgaagccac acagtgatat tgatttgctg gttacggtga ccgtaaggct tgatgaaaca 2580 acgcggcgag ctttgatcaa cgaccttttg gaaacttcgg cttcccctgg agagagcgag 2640 attctccgcg ctgtagaagt caccattgtt gtgcacgacg acatcattcc gtggcgttat 2700 ccagctaagc gcgaactgca atttggagaa tggcagcgca atgacattct tgcaggtatc 2760 ttcgagccag ccacgatcga cattgatctg gctatcttgc tgacaaaagc aagagaacat 2820 agcgttgcct tggtaggtcc agcggcggag gaactctttg atccggttcc tgaacaggat 2880 ctatttgagg cgctaaatga aaccttaacg ctatggaact cgccgcccga ctgggctggc 2940 gatgagcgaa atgtagtgct tacgttgtcc cgcatttggt acagcgcagt aaccggcaaa 3000 atcgcgccga aggatgtcgc tgccgactgg gcaatggagc gcctgccggc ccagtatcag 3060 cccgtcatac ttgaagctag gcaggcttat cttggacaag aagatcgctt ggcctcgcgc 3120 gcagatcagt tggaagaatt tgttcactac gtgaaaggcg agatcaccaa agtagtcggc 3180 aaataaagct ctagtggatc tccgtacccc cgggggatct ggctcgcggc ggacgcacga 3240 cgccggggcg agaccatagg cgatctccta aatcaatagt agctgtaacc tcgaagcgtt 3300 tcacttgtaa caacgattga gaatttttgt cataaaattg aaatacttgg ttcgeatttt 3360 tgtcatccgc ggtcagccgc aattctgacg aactgcccat ttagctggag atgattgtac 3420 atccttcacg tgaaaatttc tcaagcgctg tgaacaaggg ttcagatttt agattgaaag 3480 gtgagccgtt gaaacacgtt cttcttgtcg atgacgacgt cgctatgcgg catcttatta 3540 ttgaatacct tacgatccac gccttcaaag tgaccgcggt agccgacagc acccagttca 3600 caagagtact ctcttccgcg acggtcgatg tcgtggttgt tgatctaaat ttaggtcgtg 3660 aagatgggct cgagatcgtt cgtaatctgg cggcaaagtc tgatattcca atcataatta 3720 tcagtggcga ccgccttgag gagacggata aagttgttgc actcgagcta ggagcaagtg 3780 attttatcgc taagccgttc agtatcagag agtttctagc acgcattcgg gttgccttgc 3840 gcgtgcgccc caacgttgtc cgctccaaag accgacggtc tttttgtttt actgactgga 3900 cacttaatct caggcaacgt cgcttgatgt ccgaagctgg cggtgaggtg aaacttacgg 3960 caggtgagtt caatcttctc ctcgcgtttt tagagaaacc ccgcgacgtt ctatcgcgcg 4020 agcaacttct cattgccagt cgagtacgcg acgaggaggt ttatgacagg agtatagatg 4080 ttctcatttt gaggctgcgc cgcaaacttg aggcagatcc gtcaagccct caactgataa 4140 syngenta aaacagcaagaggtgccggttatttctttgacgcggacgtgcaggtttcgcacgggggga4200 cgatggcagcctgagccaattcccagatccccgaggaatcggcgtgagcggtcgcaaacc4260 atccggcccggtacaaatcggcgcggcgctgggtgatgacctggtggagaagttgaaggc4320 cgcgcaggccgcccagcggcaacgcatcgaggcagaagcacgccccggtgaatcgtggca4380 agcggccgctgatcgaatccgcaaagaatcccggcaaccgccggcagccggtgcgccgtc4440 gattaggaagccgcccaagggcgacgagcaaccagattttttcgttccgatgctctatga4500 cgtgggcacccgcgatagtcgcagcatcatggacgtggccgttttccgtctgtcgaagcg4560 tgaccgacgagctggcgaggtgatccgctacgagcttccagacgggcacgtagaggtttc4620 cgcagggccggccggcatggccagtgtgtgggattacgacctggtactgatggcggtttc4680 ccatctaaccgaatccatgaaccgataccgggaagggaagggagacaagcccggccgcgt4740 gttccgtccacacgttgcggacgtactcaagttctgccggcgagccgatggcggaaagca4800 gaaagacgacctggtagaaacctgcattcggttaaacaccacgcacgttgccatgcagcg4860 tacgaagaaggccaagaacggccgcctggtgacggtatccgagggtgaagccttgattag4920 ccgctacaagatcgtaaagagcgaaaccgggcggccggagtacatcgagatcgagctagc4980 tgattggatgtaccgcgagatcacagaaggcaagaacccggacgtgctgacggttcaccc5040 cgattactttttgatcgatcccggcatcggccgttttctctaccgcctggcacgccgcgc5100 cgcaggcaaggcagaagccagatggttgttcaagacgatctacgaacgcagtggcagcgc5160 cggagagttcaagaagttctgtttcaccgtgcgcaagctgatcgggtcaaatgacctgcc5220 ggagtacgatttgaaggaggaggcggggcaggctggcccgatcctagtcatgcgctaccg5280 caacctgatcgagggcgaagcatccgccggttcctaatgtacggagcagatgctagggca5340 aattgccctagcaggggaaaaaggtcgaaaaggtctctttcctgtggatagcacgtacat5400 tgggaacccaaagccgtacattgggaaccggaacccgtacattgggaacccaaagccgta5460 cattgggaaccggtcacacatgtaagtgactgatataaaagagaaaaaaggcgatttttc5520 cgcctaaaactctttaaaacttattaaaactcttaaaacccgcctggcctgtgcataact5580 gtctggccagcgcacagccgaagagctgcaaaaagcgcctacccttcggtcgctgcgctc5640 cctacgccccgccgcttcgcgtcggcctatcgcggccgctggccgctcaaaaatggctgg5700 cctacggccaggcaatctaccagggcgcggacaagccgcgccgtcgccactcgaccgccg5760 gcgctgaggtctgcctcgtgaagaaggtgttgctgactcataccaggcctgaatcgcccc5820 atcatccagccagaaagtgagggagccacggttgatgagagctttgttgtaggtggacca5880 gttggtgattttgaacttttgctttgccacggaacggtctgcgttgtcgggaagatgcgt5940 gatctgatccttcaactcagcaaaagttcgatttattcaacaaagccgccgtcccgtcaa6000 gtcagcgtaatgctctgccagtgttacaaccaattaaccaattctgattagaaaaactca6060 70094 syngenta tcgagcatca aatgaaactg caatttattc atatcaggat tatcaatacc atatttttga 6120 aaaagccgtt tctgtaatga aggagaaaac tcaccgaggc agttccatag gatggcaaga 6180 tcctggtatc ggtctgcgat tccgactcgt ccaacatcaa tacaacctat taatttcccc 6240 tcgtcaaaaa taaggttatc aagtgagaaa tcaccatgag tgacgactga atccggtgag 6300 aatggcaaaa gctctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 6360 tgggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg 6420 agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc 6480 aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt 6540 gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag 6600 tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc 6660 cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc 6720 ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt 6780 cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt 6840 atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc 6900 agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa 6960 gtggtggcct aactacggct acactagaag aacagtatt~ ggtatctgcg ctctgctgaa 7020 gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg 7080 tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga 7140 agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg 7200 gattttggtc atgagattat caaaaaggat cttcacctag atccttttga tccggaatta 7260 attcctgtgg ttggcatgca catacaaatg gacgaacgga taaacctttt cacgcccttt 7320 taaatatccg attattctaa taaacgctct tttctcttag gtttacccgc caatatatcc 7380 tgtcaaacac tgatagttta aactgaaggc gggaaacgac aatctgatca tgagcggaga 7440 attaagggag tcacgttatg acccccgccg atgacgcggg acaagccgtt ttacgtttgg 7500 aactgacaga accgcaacgc tgcaggaatt ggccgcagcg gccatttaaa tcaattgggc 7560 gcgtacgtag cactagtgcg cgatcgctta attaagcggc gcgcctgcag gcggccgcac 7620 aattattata tcaaaatggc aaaaacattt aatacgtatt atttaagaaa aaaatatgta 7680 ataatatatt tatattttaa tatctattct tatgtatttt ttaaaaatct attatatatt 7740 gatcaactaa aatattttta tatctacact tattttgcat ttttatcaat tttcttgcgt 7800 tttttggcat atttaataat gactattctt taataatcga tcattattct tacatggtac 7860 atattgttgg aaccatatga agtgtccatt gcatttgact atgtggatag tgttttgatc 7920 Syngenta caggc~.tccatttgccgcttattaattaatttggtaacagtccgtactaatcagttactt 7980 atcct~ficctccatcataattaatcttggtagtctcgaatgccacaacactgactagtctc 8040 ttggatcataagaaaaagccaaggaacaaaagaagacaaaacacaatgggagtatccttt 8100 gcatag;caatgtctaagttcataaaattcaaacaaaaacgcaatcacacacagtggacat 8160 cacttatccactagctgatcaggatcgccgcgtcaagaaaaaaaaactggaccccaaaag 8220 ccatgcacaacaacacgtactcacaaaggtgtcaatcgagcagcccaaaacattcaccaa 8280 ctcaacccatcatgagcccacacatttgttgtttctaacceaacctcaaactcgtattct 8340 cttccgccacctcatttttgtttatttcaacacccgtcaaactgcatgccaccccgtggc 8400 caaatg~tccatgcatgttaacaagacctatgactataaatatctgcaatctcggcccagg 8460 ttttcartcatcaagaaccagttcaatatcctagtacaccgtattaaagaatttaagatat 8520 actccaccggatccaccatggccaagctagttttttccctttgttttctgcttttcagtg 8580 gctgctgcttcgctgagattttcggcaagaccttccgcgagggccgcttcgtgctcaagg 8640 agaagaacttcaccgtggagttcgccgtggagaagatccaccteggctggaagatatcgg 8700 gccgcgtgaagggctcgccgggccgcctcgaggtgctccgcaccaaggccccggagaagg 8760 tgctcgtgaacaactggcagtcctggggcccgtgccgcgtggtggacgccttctccttca 8820 agccgccggagatcgacccgaactggcgctacaccgcatccgtggtgccggacgtgctcg 8880 agcgcaacctgcagtccgactacttcgtggccgaggagggcaaggtgtacggcttcctct 8940 cctccaagatcgcccacccgttcttcgcggtggaggacggcgagctggtggcctacctcg 9000 agtacttcgacgtggagttcgacgacttcgtgccgctggagccgctcgtggtgctegagg 9060 acccgaacaccccgctcctcctcgagaagtacgccgagctggtgggcatggagaacaacg 9120 cccgggtgccgaagcacacgccgaccggctggtgctcctggtatcactacttcctcgacc 9180 tcacctgggaggagaccctcaagaacctcaagctcgccaagaacttcccgttcgaggtgt 9240 tccagatcgacgacgcctacgagaaggacatcggcgactggctcgtgacccgcggcgact 9300 tcccgtccgtggaggagatggccaaggtgatcgccgagaacggcttcatccccggcatct 9360 ggaccgccccgttctccgtgtccgagactagtgacgtgttcaacgagcacccggactggg 9420 tggtgaaggagaacggcgagccgaagatggcctaccgcaactggaacaagaagatttacg 9480 ccctcga~.cctctccaaggacgaggtgctcaactggctcttcgacctcttctcctccctcc 9540 gcaagatgggctaccgctacttcaagatcgacttcctcttcgcgggcgccgtgccggggg 9600 agcgcaagaagaacatcaccccgatccaggccttccgcaagggcatcgagaccatccgca 9660 aggccgtgggggaggactccttcatcctcggctgcggctcccccctcctcccggccgtgg 9720 gctgcgtggatggcatgcgcatcggcccggacaccgccccgttctggggagagcacatcg 9780 aggacaacggcgccccggcggcccgctgggccctccgcaacgccatcacccgctacttca 9840 tttttggcat atttaataat gactattctt taataatcga tcattattct tacatggtac 7860 atattgttgg aaccatatga agtgtccatt g 70094 Syngenta tgcacgaccg cttctggctc aacgacccgg actgcctcat cctccgcgag gagaagaccg 9900 acctcaccca gaaggagaag gagctgtact cctacacctg cggcgttcta gacaacatga 9960 tcatcgagtc cgacgacctc tccctcgtgc gcgaccacgg caagaaggtg ctcaaggaga 10020 ccctcgagct gctcgggggc aggccgcgcg tgcagaacat catgtccgag gacctccgct 10080 acgagatcgt gtcctcgggc accctctccg gcaacgtgaa gatcgtggtg gacctcaact 10140 cccgcgagta ccacctcgag aaggagggca agtcctccct caagaagcgc gtggtgaagc 10200 gggaggacgg caggaacttc tacttctacg aggagggcga gcgcgagtga aagcttgacg 10260 tcactagtgc gatcgcgcta gccatggccg gcctaggcgc ccgggagatc cccgaatttc 10320 cccgatcgtt caaacatttg gcaataaagt ttcttaagat tgaatcctgt tgccggtctt 10380 gcgatgatta tcatataatt tctgttgaat tacgttaagc atgtaataat taacatgtaa 10440 tgcatgacgt tatttatgag atgggttttt atgattagag tcccgcaatt atacatttaa 10500 tacgcgatag aaaacaaaat atagcgcgca aactaggata aattatcgcg cgcggtgtca 10560 tctatgttac tagatcggga attcctcgag tctagacctg cagg 10604 <210> 4 <211> 8757 <212> DNA
    <213> Artificial <220>

    <223> pBSC11369 <400> 4 aagcttctggcagacaaagtggcagacatactgtcccacaaatgaagatggaatctgtaa60 aagaaaacgcgtgaaataatgcgtctgacaaaggttaggtcggctgcctttaatcaatac120 caaagtggtccctaccacgatggaaaaactgtgcagtcggtttggctttttctgacgaac180 aaataagattcgtggccgacaggtgggggtccaccatgtgaaggcatcttcagactccaa240 taatggagcaatgacgtaagggcttacgaaataagtaagggtagtttgggaaatgtccac300 tcacccgtcagtctataaatacttagcccctccctcattgttaagggagcaaggatccac360 cggtcgccaccatggcccagtccaagcacggcctgaccaaggagatgaccatgaagtacc420 gcatggagggctgcgtggacggccacaagttcgtgatcaccggcgagggcatcggctacc480 ccttcaagggcaagcaggccatcaacctgtgcgtggtggagggcggccccttgcccttcg540 ccgaggacatcttgtccgccgccttcatgtacggcaaccgcgtgttcaccgagtaccccc600 aggacatcgtcgactacttcaagaactcctgccccgccggctacacctgggaccgctcct660 tcctgttcgaggacggcgccgtgtgcatctgcaacgccgacatcaccgtgagcgtggagg720 agaactgcatgtaccacgagtccaagttctacggcgtgaacttccccgccgacggccccg780 70094 Syngenta tgatgaagaa gatgaccgac aactgggagc cctcctgcga gaagatcatc cccgtgccca 840 agcagggcat cttgaagggc gacgtgagca tgtacctgct gctgaaggac ggtggccgct 900 tgcgctgcca gttcgacacc gtgtacaagg ccaagtccgt gccccgcaag atgcccgact 960 ggcacttcat ccagcacaag ctgacccgcg aggaccgcag cgacgccaag aaccagaagt 1020 ggcacctgac cgagcacgcc atcgcctccg gctccgcctt gccctgctct agatcccgaa 1080 tttccccgat cgttcaaaca tttggcaata aagtttctta agattgaatc ctgttgccgg 1140 tcttgcgatg attatcatat aatttctgtt gaattacgtt aagcatgtaa taattaacat 1200 gtaatgcatg acgttattta tgagatgggt ttttatgatt agagtcccgc aattatacat 1260 ttaatacgcg atagaaaaca aaatatagcg cgcaaactag gataaattat cgcgcgcggt 1320 gtcatctatg ttactagatc gggaattggg gaaatttacc ggtgccgaat ttccccgatc 1380 cagcttctgg cagacaaagt ggcagacata ctgtcecaca aatgaagatg gaatctgtaa 1440 aagaaaacgc gtgaaataat gcgtctgaca aaggttaggt cggctgcctt taatcaatac 1500 caaagtggtc cctaccacga tggaaaaact gtgcagtcgg tttggctttt tctgacgaac 1560 aaataagatt cgtggccgac aggtgggggt ccaccatgtg aaggcatctt cagactccaa 1620 taatggagca atgacgtaag ggcttacgaa ataagtaagg gtagtttggg aaatgtccac 1680 tcacccgtca gtctataaat acttagcccc tccctcattg ttaagggagc aaggatccat 1740 gaaaaagcct gaactcaccg cgacgtctgt cgagaagttt ctgatcgaaa agttcgacag 1800 cgtctccgac ctgatgcage tctcggaggg cgaagaatct cgtgctttca gcttcgatgt 1860 aggagggcgt ggatatgtcc tgcgggtaaa tagctgcgcc gatggtttet acaaagatcg 1920 ttatgtttat cggcactttg catcggccgc gctcccgatt ccggaagtgc ttgacattgg 1980 ggaattcagc gagagcctga cctattgcat ctcccgccgt gcacagggtg tcacgttgca 2040 agacctgcct gaaaccgaac tgcccgctgt tctgcagccg gtcgcggagg ccatggatgc 2100 gatcgctgcg gccgatctta gccagacgag cgggttcggc ccattcggac cgcaaggaat 2.60 cggtcaatac actacatggc gtgatttcat atgcgcgatt gctgatcccc atgtgtatca 2220 ctggcaaact gtgatggacg acaccgtcag tgcgtccgtc gcgcaggctc tcgatgagct 2280 gatgctttgg gccgaggact gccccgaagt ccggcacctc gtgcacgcgg atttcggctc 2340 caacaatgtc ctgacggaca atggccgcat aacagcggtc attgactgga gcgaggcgat 2400 gttcggggat tcccaatacg aggtcgccaa catcttcttc tggaggccgt ggttggcttg 2460 tatggagcag cagacgcgct acttcgagcg gaggcatccg gagcttgcag gatcgccgcg 2520 gctccgggcg tatatgctcc gcattggtct tgaccaactc tatcagagct tggttgacgg 2580 caatttcgat gatgcagctt gggcgcaggg tcgatgcgac gcaatcgtcc gatccggagc 2640 cgggactgtc gggcgtacac aaatcgcccg cagaagcgcg gccgtctgga ccgatggctg 2700 70094 Syngenta tgtagaagta ctcgccgata gtggaaaccg acgccccagc actcgtccga gggcaaagga 2760 atagggatcc cccgaatttc cccgatcgtt caaacatttg gcaataaagt ttcttaagat 2820 tgaatcctgt tgccggtctt gcgatgatta tcatataatt tctgttgaat tacgttaagc 2880 atgtaataat taacatgtaa tgcatgacgt tatttatgag atgggttttt atgattagag 2940 tcccgcaatt atacatttaa tacgcgatag aaaacaaaat atagcgcgca aactaggata 3000 aattatcgcg cgcggtgtca tctatgttac tagatcggga attagcggcc cgaattcact 3060 ggccgtcgtt ttacaatgtc gtgactggga aaaccctggc gttacccaac ttaatcgcct 3120 tgcagcacat ccccctttcg ccaggggcgg ccagcatggc cgtatccgca atgtgttatt 3180 aagttgtcta agcgtcaatt tgtttacacc acaatatatc ctgecaccag ccagccaaca 3240 gctccccgac cggcagctcg gcacaaaatc accactcgat acaggcagcc catcagaatt 3300 aattctcatg tttgacagct tatcatcgac tgcacggtgc accaatgctt ctggcgtcag 3360 gcagccatcg gaagctgtgg tatggctgtg caggtcgtaa atcactgcat aattcgtgtc 3420 gctcaaggcg cactcccgtt ctggataatg ttttttgcgc cgacatcata acggttctgg 3480 caaatattct gaaatgagct gttgacaatt aatcatccgg ctcgtataat gtgtggaatt 3540 gtgagcggat aacaatttca cacaggaaac agaccatgag ggaagcgttg atcgccgaag 3600 tatcgactca actatcagag gtagttggcg tcatcgagcg ccatctcgaa ccgacgttgc 3660 tggccgtaca tttgtacggc tccgcagtgg atggcggcct gaagccacac agtgatattg 3720 atttgctggt tacggtgacc gtaaggcttg atgaaacaac gcggcgagct ttgatcaacg 3780 accttttgga aacttcggct tcccctggag agagcgagat tctccgcgct gtagaagtca 3840 ccattgttgt gcacgacgac atcattccgt ggcgttatcc agctaagcgc gaactgcaat 3900 ttggagaatg gcagcgcaat gacattcttg caggtatctt cgagccagcc acgatcgaca 3960 ttgatctggc tatcttgctg acaaaagcaa gagaacatag cgttgccttg gtaggtccag 4020 cggcggagga actctttgat ccggttcctg aacaggatct atttgaggcg ctaaatgaaa 4080 ccttaacgct atggaactcg ccgcccgact gggctggcga tgagcgaaat gtagtgctta 4140 cgttgtcccg catttggtac agcgcagtaa ccggcaaaat cgcgccgaag gatgtcgctg 4200 ccgactgggc aatggagcgc ctgccggccc agtatcagcc cgtcatactt gaagctaggc 4260 aggcttatct tggacaagaa gatcgcttgg cctcgcgcgc agatcagttg gaagaatttg 4320 ttcactacgt gaaaggcgag atcaccaaag tagtcggcaa ataaagctct agtggatctc 4380 cgtacccggg gatctggctc gcggcggacg cacgacgccg gggcgagacc ataggcgatc 4440 tcctaaatca atagtagctg taacctcgaa gcgtttcact tgtaacaacg attgagaatt 4500 tttgtcataa aattgaaata cttggttcgc atttttgtca tccgcggtca gccgcaattc 4560 Syngenta tgacgaactgcccatttagctggagatgattgtacatccttcacgtgaaaatttctcaag4620 cgctgtgaacaagggttcagattttagattgaaaggtgagccgttgaaacacgttcttct4680 tgtcgatgacgacgtcgctatgcggcatcttattattgaataccttacgatccacgcctt4740 caaagtgaccgcggtagccgacagcacccagttcacaagagtactctcttccgcgacggt4800 cgatgtcgtggttgttgatctagatttaggtcgtgaagatgggctcgagatcgttcgtaa4860 tctggcggcaaagtctgatattccaatcataattatcagtggcgaccgccttgaggagac4920 ggataaagttgttgcactcgagctaggagcaagtgattttatcgctaagccgttcagtat4980 cagagagtttctagcacgcattcgggttgccttgcgcgtgcgccccaacgttgtccgctc5040 caaagaccgacggtctttttgttttactgactggacacttaatctcaggcaacgtcgctt5100 gatgtccgaagctggcggtgaggtgaaacttacggcaggtgagttcaatcttctcctcgc5160 gtttttagagaaaccccgcgacgttctatcgcgcgagcaacttctcattgccagtcgagt5220 acgcgacgaggaggtttatgacaggagtatagatgttctcattttgaggctgcgccgcaa5280 acttgaggcagatccgtcaagccctcaactgataaaaacagcaagaggtgccggttattt5340 ctttgacgcggacgtgcaggtttcgcacggggggacgatggcagcctgagccaattccca5400 gatccccgaggaatcggcgtgagcggtcgcaaaccatccggcccggtacaaatcggcgcg5460 gcgctgggtgatgacctggtggagaagttgaaggccgcgcaggccgcccagcggcaacgc5520 atcgaggcagaagcacgccccggtgaatcgtggcaagcggccgctgatcgaatccgcaaa5580 gaatcccggcaaccgccggcagccggtgcgccgtcgattaggaagccgcccaagggcgac5640 gagcaaccagattttttcgttccgatgctctatgacgtgggcacccgcgatagtcgcagc5700 atcatggacgtggccgttttccgtctgtcgaagcgtgaccgacgagctggcgaggtgatc5760 cgctacgagcttccagacgggcacgtagaggtttccgcagggccggccggcatggccagt5820 gtgtgggattacgacctggtactgatggcggtttcccatctaaccgaatccatgaaccga5880 taccgggaagggaagggagacaagcccggccgcgtgttccgtccacacgttgcggacgta5940 ctcaagttctgccggcgagccgatggcggaaagcagaaagacgacctggtagaaacctgc6000 attcggttaaacaccacgcacgttgccatgcagcgtacgaagaaggccaagaacggccgc6060 ctggtgacggtatccgagggtgaagccttgattagccgctacaagatcgtaaagagcgaa6120 accgggcggccggagtacatcgagatcgagctagctgattggatgtaccgcgagatcaca6180 gaaggcaagaacccggacgtgctgacggttcaccccgattactttttgatcgatcccggc6240 atcggccgttttctctaccgcctggcacgccgcgccgcaggcaaggcagaagccagatgg6300 ttgttcaagacgatctacgaacgcagtggcagcgccggagagttcaagaagttctgtttc6360 accgtgcgcaagctgatcgggtcaaatgacctgccggagtacgatttgaaggaggaggcg6420 gggcaggctggcccgatcctagtcatgcgctaccgcaacctgatcgagggcgaagcatcc6480 Page ZO

    70094 syngenta gccggttcctaatgtacggagcagatgctagggcaaattgccctagcaggggaaaaaggt6540 cgaaaaggtctctttcctgtggatagcacgtacattgggaacccaaagccgtacattggg6600 aaccggaacccgtacattgggaacccaaagccgtacattgggaaccggtcacacatgtaa6660 gtgactgatataaaagagaaaaaaggcgatttttccgcctaaaactctttaaaacttatt6720 aaaactcttaaaacccgcctggcctgtgcataactgtctggccagcgcacagccgaagag6780 ctgcaaaaagcgcctacccttcggtcgctgcgctccctacgccccgccgcttcgcgtcgg6840 cctatcgcggccgctggccgctcaaaaatggctggcctacggccaggcaatctaccaggg6900 cgcggacaagccgcgccgtcgccactcgaccgccggcgctgaggtctgcctcgtgaagaa6960 ggtgttgctgactcataccaggcctgaatcgccccatcatccagccagaaagtgagggag7020 ccacggttgatgagagctttgttgtaggtggaccagttggtgattttgaacttttgcttt7080 gccacggaacggtctgcgttgtcgggaagatgcgtgatctgatccttcaactcagcaaaa7140 gttcgatttattcaacaaagccgccgtcccgtcaagtcagcgtaatgctctgccagtgtt7200 acaaccaattaaccaattctgattagaaaaactcatcgagcatcaaatgaaactgcaatt7260 tattcatatcaggattatcaataccatatttttgaaaaagccgtttctgtaatgaaggag7320 aaaactcaccgaggcagttccataggatggcaagatcctggtatcggtctgcgattccga7380 ctcgtccaacatcaatacaacctattaatttcccctcgtcaaaaataaggttatcaagtg7440 agaaatcaccatgagtgacgactgaatccggtgagaatggcaaaagctctgcattaatga7500 atcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctc7560 actgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcg7620 gtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggc7680 cagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgc7740 ccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacagga7800 ctataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgacc7860 ctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcat7920 agctcacgctgtaggtat cagttcggtgtaggtcgttcgctccaagctgggctgtgtg7980 ct cacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtcc8040 aacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcaga8100 gcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacact8160 agaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagtt8220 ggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaag8280 cagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacgggg8340 Syngenta tctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaa 8400 aggatcttcacctagatccttttgatccggaattaattcctgtggttggcatgcacatac 8460 aaatggacgaacggataaaccttttcacgcccttttaaatatccgattattctaataaac 8520 gctcttttctcttaggtttacccgccaatatatcctgtcaaacactgatagtttaaactg 8580 aaggcgggaaacgacaatctgatcatgagcggagaattaagggagtcacgttatgacccc 8640 cgccgatgacgcgggacaagccgttttacgtttggaactgacagaaccgcaacgctgcag 8700 gaattggccgcagcggccatttaaatcaattgggcgcgccgaattcgagcttggtac 8757

    Classifications
    International ClassificationC12N15/09, C12N15/82, A01H5/00
    Cooperative ClassificationC12N15/8205
    European ClassificationC12N15/82A4B
    Legal Events
    DateCodeEventDescription
    Jun 9, 2008EEERExamination request
    Jun 17, 2010FZDEDead